Description :
From Genome Similarity Track
Location :
Scaffold_42:394005- 395029
Sequence
1024 bases(100 bases per row)
CCCAGCGTGTGCGTGGGGGCTCGATGGTGGCACCCGTCAGCCAGGGAGCTGCCATCAACTCAAGAGGGTATTGGCCTCCCGAGGAGCGGGAACTCCATGA
AGATCACCTGCTGTCCCACATCCTGGACCAGCGTGATCTTCGTATGAGGTTCGCCCACTTGATCAGCAAGCGTATGCTGCCAAGGGACATCCTGAAGCGC
GCGGCTTCTAGCGCTCACGATGAGCGTGGGTACGGTATGTATTCATCGTCCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACTAATGAAGCTTCCGCCG
CTTCTGTTCCCAGATTGCGACAGCCTTCGGGCAGTCAATCAGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAGCCCCTCCACTTCACG
AGGAGCTCTCGCTTACCGCGACACCGTTGCTCCTGGAGGATCCGCTCCACGTAGAAGTGGACTTCTCCATTCCGGTCAAGCAGGGGCGGAGGTGCCCTCG
TACGAGTACGAGTACTCGGCGCCTCCCGAGAGCCACTCTCGTCTGAGTGCTCCGACTGCGGGTCCGACACAGGACCCTGAGGTTGACCGCCTCCGTCAAC
GTGTCCTCGTTCTTGAGATTGCACTTGGCCTTGGGACTGGCGGTAATGCTGCCGCCCAGGCCGGGAATCAGGGCGAGCTCGCTCGTCTTGCGGGTTGCCT
GGACCTGGTGGAGCGAGAGGTCGCGAGCCTGCACCTGCGGGTGGATCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTTCGAATGATCCGACGGATC
GAGGCTTTGTTGCCACGTCCGGAGCCGCCTGCGGCACACTCCCAGACGTACGCGTATGGTGCGTACCCGGCGTACTCAGCGTACTCGGCGTATGGCACCG
GGGTCCGTTCGTATGGAGCCCCTCCGGCGTACGGTCTTGACCGCAGCCTTGCCGTCCCGACCGAGGCTTGGGTGCCTGCTCCGACGACCTCGTCGACGAC
TGTGACCGGCCCTCGCTTCGAGGA