Description :
From Genome Similarity Track
Location :
Scaffold_2483:394- 4281
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2483-fgenesh-gene-0.0Telomerase reverse transcriptase

Sequence
3887 bases(100 bases per row)
AATCATCACTGAGAAACTGTGCAGCCCAACATGCCAGACCAGACCGTCCACTTCGGCCTGCTGCTGCTTGGTGCCTTCCAAGAGCGTGCGCTGGATGCCT
CGAGATGTCTTCATAAGAATCTTCCGCACGCAGTCGTAAAGGAAGGAGGTGGAAGAAGACGTAGGTAGCTTGTCCACGAGCAGCACGAATCGCAGCGCTG
CGAGGCACAGCAGTTGGTAGACATTGACCTATTTGGTTCAGTAGCATTGCATCACGAGATAAGTCGCTTTTACGCTGGGAGATATTCCGCCCTGAAACGA
GAAAAAGCAGATCACGAACCTGGATCGTGGATCGATACAGCATGTTCGGGTCGAAGTAGAGACGATGCCACCGCTGGCGAACGGCCGAAATGACTTTGTT
GACGAACACTGCACCGATATTCTTGGTATCGTCGACTGGAACAGACGCAACCACGACGTTCAAGCTGAGCCTACTCAAACCAAAACTGCGTGAGCTATGA
CGCACAGTGCATCCAATGCCAGAGAGTAATTACTTGTCGTAATTGGCATAGACTTGGAGAGAGTCTGGATCGAGGAGCAGGCCACACCATGCAAGAAGAG
GGGTGGTTGCGTCGGCATCACTGGGCTGATCAACTCGCGGGATTTCCCGCATCTCTCCGTCAGCATCGACGATGAGGACGGGAAAGTTGACACGGCTCTT
CTTTAGATTCACGAAACATCCGTAGTCATGGTTGCCGCGATGCATCAGCTGAGCAAACTCGCGGGCCTTCTCTTGATCAGTGGATACGAAGAGGTAATCG
TCGGTGTATCGCATGATAAGCTCGTGGCTGCAATCGACGATCTCGGTCTGACTACTTACCATTGCTTGCATTTGTTTCTGCAGCACTCGCTTCTCGAAGT
GCGCATAGTACAAATTGCATAGTGTGGTCGAGAGAACGGATCCTTGTGGAATTCCTTGCCGCTGAGCGTAGAGCTGATCATTTGCTTGCACTGTGTTCGC
CGTCAGGTGTTCTCGAAGTAGCGTCAGTATCTTGGCCTTCGAAATGTAGTCGTATAACACGCCATCGACAAAAACGGCGTCTTTCTTCTTGGCGATGTCT
TGGACAAGCTGGTCATAGCCCTTCAGGTCGCCTGATGGAAACGCAGGACGCTCCATCTTGTAGTATGCACCCTTGCACACCCAGTGCTTGCGAACGAGGT
ATTCTTCCTCAGCAAAAACCTTCTTCAGCACTCGTAGGAGCTTTTTCGGACGTATCGTGTCGAAACAGCGTTCCACGTCAACCGTCACGCAATACAGTTT
ACGACCCTCGACATGAGCACAGCGTGGACACGCTTGGATGCGAGAGGTGAGGTTCTTCAGTTTCGCATGGATCTCGTCCACGTTCCGGACCGTTGAACCG
AGTAGCCGGTCCGATTGGCGATCGATCTCGAAGAGAAGTGCCCTATGGACGAGCTCGAGTGAACGGTTCACGGAAATGTCCATATCGAGGCTCTTTCCAG
ACAGATTCATGAGCGGGCGAACTCCGCTGATCTTCGGAAGTAATCGAAGTCTGGAAACTCCGAGCTGGCTGGAGACGAGTGCCGTCTCTGTTGTGGTGGT
CGGCTTCAAGATCGATGCCGACAAATCGTACAGCGCCAAATTGCTGGATCACCAATTCACACGTGTAAAGACTTCGAACGTTCGTCAAACAACCACGGAG
ATGACTCGTACCTGATAATCGTCCACACCGGTCGAGAGTAATAGAAGACTTCATTAGCCGAACCCTCCGACTCAGTGATGTAGAAACAGTTGCGCAAAAT
CGGAAAGACGATATTGCGGATCACCCACTGCAACACCTGACTCATTAGTTTCCGACGGGCAAGTAACTCATTCGGCGGACTGGTTGATCAAGAGCTCAAC
GTCAGATCATGGAATCAAGGTGATCAGAACAATCTTGCCAACTTGCGTACCAAATCGACTTTCCCGATGCATTCATCCACCCGACCTCCTTGACGCCAAA
CCCATTCGCCACCTAGAAAAGCCAGAGAATGGTCGAGCAACCGTGGGAATTCATCACGATAAATACACACATACCCGATCAATACACAGGATGTCGTACT
TCCTTGACGAGATGAGTCGATCAATGAACAGTTTCATCTTGGACCAGTTGGAATCTTGCTTTCGCCGATCGGTCAATGGCTTCCCAAATAACGACTTTGG
AAGAATGGCTGCCAGTACTTTCCGAACAACTCGCCGCACCCTCCGCTTGGGAACCTTAATCTGCAGCAGATGTGCAATCTCATCGCGATGGCGCTGAAGG
TGTGTGAGCTGCGCCACACACATCGGAGACTCCACCACATCCAGTTTGCCGGCGTCTTCTTGCTCAAACCGAACCTTCCTCACTGCCTTCCTCTCGACGG
CCACCGTTGCGGAGTTACTAGACAACGCTGCCACTGCGACTTCCCTCCGCTTTCTTTTGCGACTCTCTCTTGAATCTGGCGACTCAGTCTGACTGTGATA
TCCTTCCTCGTCGATTCTGACCACCAATGGATCCAAGCTTGGACTCGCGCCACCAGATGAAGCTGCTCGTGATGCATTCGCGAACAGCACATCTCGAACA
TCCCGATGGTCTCGCAGGAATTCAGTTAGCTCTGGAGGCGTCGGGAGTAGTCGAGAGACGATCCCATCGATGTCTGTTGTCTGCACTCGCTGTAGCAGCT
CTTGGGCGATGGGCACGAGGTTAAGGAGACGCTTGGGCAGTCGCTTCTCGTTCTTAGCATCCGGAAACACCGAGCAAATGAGTTTCGATGCCTGACCACG
ACTGACAGAATCTCCGCCCGAGCTCGATGCGGCTGCAAGCTCCGACTTGGCGAAGATCTTACGCTTCTTAAAATGTCTTGCATACATGACATGGTTGATT
GATACCGTCGACGAGCTGGTTTCTGACGCCGGAGCGACACTGTGTGGCTTGGCATCATACGTCTTCTTCCTCTTCTTGCTCTGGTGCTGGTTATCTGGAG
CATGCGTAGGCTCTTGAAGGGGTCGCTTCATCCAGCGGAGACTGTTGCCAGCGACCTACAGAGTAAAACTCTAAAGTCAGCAGCACCACCCAGACCATTT
CCACCAACTCGCCGAACCTGAATGTAGGATCCGCTTGGCTGCGGTACTTTCACAAAGATGCAGTAGTTCAGGAGAAGATGCACCAGTAAATCGTCACCTA
TGAGTGCATGCAGTGCCTCCCACACTGCAGTCTTGAGCGTCGCGACTAGCGTATTCGGAAAGTAACACATGACCGAATTCGACGCTGTCACGCGGTGGCC
GTGTGAACCAGGTGCGACCTCACGGTAGCCCAGCGTGAGGAGATTCGAGTCGCTCGGGTCGGTGCGCCGTCGCGTGAGAAGCCGCTCGATGACCAATGCG
ATAACCTCGCTCTGTGAACATGCGATCACGAGAATGAGGAAGGCTGTCTATGATGGCAGTAAATGAGGTGATGGCATGCGCTACCAACTGAAGAGATTGC
ACCGAGGACCACGGAAGTCTTGGGTACGGAGATGAAGCTTTGTAGTAGTGGTAGACGACCGTCTCATGGAGCAGCCGCTTGAGCTCGGGACATCGCACGC
TTCGAATCGCTGATTGACGTTCAACTCGGTCGACCTCGTGGGGGCATGTTGCGACGGCTCTACACACCGCACAGCCACCACGGGAGCGTCAAACGATGCG
TATCATTTTGCGGCAGAAGCTACACCCATTTGGAGACGACTTACTCGAGTAGAAATGAGCGGAGAGACGTCCGCGCGTCGCCAAGCACCTCCATGTTTCA
CACTTCCTCATGCGCGGGAAGAAAAGGAAACCTTTTGCTAAGTACGAATTTCGTTTTCCGCTAAGTTCACATTCCAGGAATGATTGT