Description :
From Genome Similarity Track
Location :
Scaffold_1672:394- 2205
Sequence
1811 bases(100 bases per row)
ACCTCGAAGTTATATTCCGCAAAGAAGGTAAGCCACTGAGCCATTCTCTGAGAGAGTTGAGGTGACTGTTTCGCCGTGCGTAATGACGCATGATCCGTAT
AGATGAAGAATGGCTTGAAGCCAAGCAGATGGACTCTAAATTTGACGAGCGCATACTTCATAGCAAGTAGCTCTTTGTCATGGACTGGATAGTTCTTTTC
AGCAGCTTTCAGCTGACGTGATTCAAATGCGATATCTCGCTCGCGGTCTGCAGCATCTGATTGTAACAGAGCGCTGCCTATGGCACGTCGGATGCATCGC
AGACAACACTGAAAGGGTACTCCGGATTCGGCAACGCCAAAATGGGAGCATGAAGGAGACTCTCCTTGATTGACCGAAATGCTTCAGCATGGGTGTTGTC
CCAGCGCCAATCTGTGTCCTTCTTAAGGAGATCAGTTAATGGCCGAGCCATATCAGCGTAATTTCTACTGTATTTGTGTAAGTAATTGGCAAGGCCAATC
CACTTACGCAAGTCCTTTTGACTCCTAGGAATCGGCCAGTCCACAATAGCTTTGAACTTAGCGGGATCCGCTCGAAGGCCGCACTTACCAATGAAACAGC
CGAGAAAAGGAATCTCCTCTGCATCGAAAATGCATTTGGACGCGTTGGCGTACAATTTATTAGTGCGCATGCACTCGAGCACGGCTCGCAAATGACCGAT
GTGGTTGTCAACATCTGACCGACCTTTTTCGGCACGACTATGGACAAAAATGTCATCAAAGTACGTCTGTGCGTAATCCCTGTGTGGGCATAAAGTTGCG
TCACCAGACGATTAAATGTTGCCGGAGAATTATACAGCCCTTGGGGCATCACCAGCCATTCCCATAGCATACCACTCGGGGTGCTCACTGCTGTAAGCGG
AATAGCACTCGCTTGCATGAGCAATTGATAATATCCATCGACCAAGTCGATTGCACTATACATAGTACAACCAACCATGTTGTTTTGAAGAACAACCTTT
CGAGGAATGGGTGTCTGTGCCGGAATCGTAGCCGCATTAAACTTGTTAGAAGCATGCACAATACGTCACTTGCCGTTCGGCTTCTTAACACAAAACGTCG
GTGTCGAATGTAGAGATTTACTCTCACATACTATTCCTGCCTCGTGCTTAGCACGGAAGAAGTCATCAATGAGATCACATTGCTCCTTAGGCAAGGGCCA
CTGTCGTGTGACACAGTATTTCGTCCCAGGAACTAAGTCAATTGCATGACGGACACCTCTATCTGGAGGTAGAAATGAGGGTGGGTCGCGGCACACCACG
TCTTGAAATTCCTGGACTAAGGAATAAAAAAAGATATCATGAGGGTCTTTCAATATTTATGACCCACTAAGCGCGCTGGGTGCTGCTTTTGTGTCCTCCG
GAACGGCTTCATCCAAAATTGAAGAATAGTTCAACTCTATGATGTCGTGTCGAATGACCACAACCTCTGAAAGGTCTCCATTCTTCATTGAGTGATCAAA
CTCATCGACCGACAACGTTTCCAATTTCTAAAAGAGAACTTAACGAGGGTATAGCCTCAAGGCTAATTTTACCATCACAGGCACCAGTCACTCCGTTGAC
GAGTGTATACAGCTGACAGTCATCATCACTTTGTGACACAGCACACGATGTGTGATTCGTATCTCTACGATCGATACCATCATCAACCGTAATTTTCTCT
AAACCAGAGCTGACGTCACTACTGACATCCGATGACGAGTCATGGACATGACGTCGTCATCACGTGATTACGTGCCACTTCACGTGCATCCGCTGAGCGG
GCTCGGGATGG