Description :
From Genome Similarity Track
Location :
Scaffold_585:394- 2187
Sequence
1793 bases(100 bases per row)
GCGAGGGTGTCTTCGGATAACGAGCTCCGAGACGAAAACGAAACAAGCACGTCAAGGAGCACTCGCGGTGGCTTATTGCCTGGGCACACACCGAGATACG
CCAATACTTACGAGCTACCAGCGAGTTAATGTACAATTTTGTTGAGGGGCGAGACGATGTCGAAGATGATCTGTTGCCGTGGTGGAAGCGCAAATCGACG
CGTTTCCCCCTTCTGGCTCAGCTCGCCAGTAAGTGCCTTTGCTGCGTGACAACTTTAGTTCCCTCTTGCGCGCTTTACCCTAAATAACAATTCGTTCAAC
CACGACAACTAGGCGGGTAGATAGATATCAATGAAACACATCACACTATCCTAATGGTGTTTGAGTTTGGATATATCCATGTAAATCATCGACATCACCC
AGCACACTTACACAAGCACACCAACGAGATCCCTCTCGCAACCCTCTTCCAACCCACCCATCGTTACCACGCCCACGTCCTCCATTTAGTCCGGTTGGTA
AACGCTTAATAAAAGCCCAGCTTTACCCTCCGACTACCATTTCATTCAACTCAAGAGGGTGGTCCAAAATCCATGCGTTTATCTCCCGGAGACGGTTCTC
CAAGGACCAGCTGGCATCTTCGTCCGGGTGAAGCTGCATATGAAGGAACAGGAAAACGTCGAGCTGGTTGGATACGACAGCACTAACGACTTCTGGAAAC
GTAAAGTCATTTGCGAGATGCTTGCGTAGCCATTTCATAACATGTAAATGGCCACTTTGTGCTGCCTTTCTCATCGCTTGAGCCGTGCAGACTTCCGGTC
TGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN