Description :
From Genome Similarity Track
Location :
scaffold_158:394- 1685
Sequence
1291 bases(100 bases per row)
TGTGTGACGcttttgagtttgcaatcgtTGTGCTGGACTcagaaagacgcgatcgtgTAGTTCCAACATAATTTCGACAGCTGAAGCCAGCAAAAAACAA
CTACCCTGTTCACGACAAGATGATTTtaacaatgaagtatgctctgGTGAAGTTCCGTGTTCACCTCTTGGGTTCAACTCCAATTGTCGTCTACACGAAG
AACGCTATCTTGCGATATGTATTTCAGTCTCCTCATTTGTCACAGCGTATGGCTCGCTGGTTGTCATTTTTTGCATAATACAACTTCACGGTTGCGTATA
AAGCGGGCAAACTAAACGTGCCGGCTGACGCATCGTCACGTCGTCCGaattatgagctagctcgTATAAGCTATATCAAAAACGATGTATTGGATATGAA
ACGACGATCGAATGTCGGGGATGAACAgtgtgatctgatcatcaaCGCGCTCTCATCGATTGATATTAAACTCTATGACAAGCGTCCTGATCGCTTGAAA
TCACGGATGCATTGTTATACATCAACAGGATGGTCTCCTTTACTATCAAGTTGCACATGACGACAAGCCACGATAATTTAAAGCACGACGTTGTGTACGA
GCGACGGCGCTCGTCGGCGGATCACTTGTCCGTATGAAGAACTATGAGTCTCCTAGTGCTCAACTTTGGTGGTAATGGGTGACATGATACGTGAACACAT
GCGATGTCTGTCTGCGCGTGGATAGCGCACGGCACCACTGCAGATACTCCCTGTTAATACTGACTGTAAGTCAGTCGGTCTCGACTTTATCTTCGGGTTC
TTTGAGAATGCTGGTGGTCACAATGAAGTAATCGTCACTGTCGACaaatcagcaagatggttcgcaTCGCTCCATTTATAGCGATTCCATCGATACCGAA
GGTTCGGCTAGATTATTCAATGCTCTCGTTTCTGTAATCACGGGTTGCCAAACGCCATACTCTCTGACCGTGATACACGATTCACGAGTGTCTTTTGGAA
AGACTCATTTTGAATTGATCCTGGCACTCGCTTGGATATGCCCACGATGGTATACCCGGAGACCGATGGGCAAACAGAACGTTCCAACCGAGTGGTCGGT
GATGTGTTGAGAAGCTTCTGTTTGACAATGCCGCAGAACGGATTTTGTTGTTACTATTGGTAAAGTTTGCTACGAGCAATTCGGTTCACTCGTTCACTGA
GCTTACGCCAATTCATATGAATGGCTTGCGCACCCGCAGTTCccgctttgtgcgatggtTAGTGTCTCTGATTTGAGTGGGGGATGATTTC