Description :
From Genome Similarity Track
Location :
Scaffold_4187:394- 1515
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_4187-snap-gene-0.2Structural maintenance of chromosomes protein 5
Pytar_ATCC12531maker-par_contig_4187-snap-gene-0.3PH domain containing protein

Sequence
1121 bases(100 bases per row)
AACCGCAAGCGACCGCGCGTCAAGGCCGAGGTCGTGCATTGATATTGGTGTGGGAATTTATATATTTTGATCGTCCTGTTTGTTTGTTTGACTGGTCGCG
GGCTGGTGGCCCTCCCCCACTAGTATATCAGCACCTGGACGCGCGTCTCGAAGGGATCTTCTTCTGGTGAACCTCTACACCGCGTAGCTTGCGGTCATTT
CGCTGGAGCTCTTCGAGCCGCAGCTTCTCGGACTGAGCGAGCATGAGGTTTCCCTGCTGCAGCGCGATGAGGTCTTCGCGGAACCGGCAGTCCGAGGCCA
ACGGGTTCGCCACAGGGCGGTGNNNNNNNNNNATTATATATTCTGATCGTCCTGTTTGTTCGTTTGACTTGGTGGCCCTCCCCCACTAGTANNNNNNNNN
NGGCGGTGCGCGAACGCCGGCTCCGACTCGATGTGCCAATACGTTTGACCATCGCATTGCAGGTGCGTGAGCCACGAGCCCTGCACGGCGACGCTCGCAG
GTTTCGTTCGGCCGCCTCCCGACTTGCAGGTTGAGACGATGCTGCCTCGAATGTCGTCGGTCTGGGTCTTGCCAAAGAGGAAGGTGCCGCTGTTGGCGTT
GCAGTGGATCTCGCCGGCGAGCTGGTTAAGCTCGTCCGTGAACTTGGCGATGCCCGCGATCTCAACGACCCGCTCGCCAAAGACAATGCCGCTCATCTGA
TGACGGAGCAGAGACAGCATAAGCCACAAGGACAAAGAAAGCCGAGACAACTGAGAGATCGTACTTTGATCTGCGGCAGCGTGTAGGTGATGCTCTGGCC
GTCGCTGAAGCGGATGGTCGTCTTGCCAATCTAAAACAGTGCTCAATCCATCAGCAAACGTATCAGCAGAGGAGAAGAGCTTTGGTCACTTTGTACCTGG
TGGTTGAAGATCGCGTTGCGGCTCGTGATGGATTCGAATTCGTAGACGCCACTCATCTCGTACAGTCCATTAGGCCCACGCACGTGGAACGCTGACTGCA
CTGGGTGGTGCGCGACGTGCTCCATGAAGATCTGCGTGCCGTCGGCGTAGCTCGCCTCGTACGTCTCGCCCAGGATCGGATTGAAGGGCTTTTGCTGGCC
GACGCAAAAGTGGAAGCCCGC