Description :
From Genome Similarity Track
Location :
Scaffold_93:39393- 40525
Transcript NameFunction/comments
Phyci_545521HECT E3 ubiquitin ligase putative

Sequence
1132 bases(100 bases per row)
CGTGAAGCCCGTCACTTCCATATTTATCACCAGCGACAGCACGTCCTCCAGCTCCTTCTTCGACTTGTACAGCGGCAAGTCGATACGGTTGAAACACGTG
TGTGCTCGCGGATACGCGTTCTCAGGGAAGGCCACGGCCTTAAGCGTGAAGTGGCAGATGCGTCCATCGTAACTGGTGAGCGCCTTGAAACCCTGCACAG
GCACACGCGAAGAACCCGTCGTGAACTGTAGTAGACGCGCGCGCTCCTCGTCCGAGAACGCCTCGACAATCTCCCAGAACCACGTAAGCAGCTCCTCCGG
CAATTCGTCCGAGACCTGAGTGTGCGCCTTCCAGTCATCCACATCGATGGAGGGCACACCGCACAACACCAGCTCTAGCTCCTGGTAGTCGAACACAAGA
ATGAGCTCCTGCGGGATCACCTCGAACACACCAGCCATCAGGTGCTGCAGCTGCTCGGCGTAGGAGTCCAGCATGATGTAGCGAAGACGCAGGTAAATGT
ACTCCTGCTTGTTCTCGTCAGTCAGCTCAATGTCCTTGCCGCCTTCCTTCAGCTCGATCGTTTCCACTTCACCGTTCAGCTTCCGGTTCGTTACCGTAAA
GTCCAGTCCCAGCGCATCCACACCGTCGTTCTCCTTCATCCACTTGAGCGAGTTGTACACTTCCTGATCAAAGAACTCCAAGTCACTGAACGAAATCGGA
ACACCGAGCAAGTGCTTCAGCACGGGCAGCGCCAAGTGAGCCTTCATGAGCTGTCCCTCCAGCAGAGCTCGGCCCAGCAAACGACCGGCACCACGGAAGT
AGAGCAGGTGGTCGGCCGAGGCCTCCACCGAGTTGGGGTTGATAACGTACGCCAGCGAGTCCACGTGCGCGCACATGAACAGCCCGATCGTCTCATCGAA
CAGCCGCTCCGTAACGAGCGAGAACCACTCGCGTTCCAGTCCGCCAGCATCAATAGCCACCTCGCCAATGAACTCGATGCGCAGCGGCATGTGGATGTGC
TCCATCTGCACGCCGAGCAGCTGCTCCATGGACTCAACCAAAATGTTCTCGCGGTGCACGCGCATCTTCAGGTGTCCGTCCTCCCAGGGCTTGATCAGCG
CCGAGGTCTGCTCCAGGAACCACGCGTACTTG