Description :
From Genome Similarity Track
Location :
contig_137:39376- 42497
Transcript NameFunction/comments
g14227.t1hypothetical protein
g14228.t1ETK96841.1 hypothetical protein L915_00530, partial [Phytophthora parasitica

Sequence
3121 bases(100 bases per row)
GGCGGTCCTCAGCTGAATCCTGCCCCATAATACTCCGGATCAAGTTTCGTGTTTGCTGGGGTGTCACCTTACATCATGTAACGTTATCAAATTCAAACAC
GATGGCCGTTAGTTCACCACCATGGACCATTAGCTGCAGCGAGCGACTTCGTACCAACGCGTTGGTTGAGAAAGTTTGCGATGTGTTTGGATGACACCCG
AGCGTCTGCCAACGTCTTCACGTCCTCACGATCCTGCTTGTCCAGAGACAATGTCTTCGTCGTATGATAGGATGCAGCCACAGAATCGGAAGTCGGATGT
GAATGCGTATGATTCTGTAGCGCAAGAAGAGCAACTGGCAGTTAGCACGATACAACATCAACGTATAATGACCAATGCGTACCTCGTTTCTGATCACTAT
CTCGTATTCGTTGGTTTCCGTCTGCACGATAGTTGGCGTCAATCGTGCCTTGCACCCGCAATACCGCGACTTTCGATTTCGATAGCCTTTTGATCGGGAC
CCCTGTTTAACTCCGTGCGTGCAGCGAAATATTCTGTAGCTCCATTCATATCGAGAAGGCAGTTGATCTTCGTCATGCGTGCTGTGCATCCACAAAAATA
GCAAGTGTTAGTTCAAGCCCGCCAATTCACTCACATAAAAATAAACTTACTGATTGTGCATCTGGGTTTTCATCGAGCTCCGGACGCGAAACTTGAGTTT
ATTCTTTCTTTTGTACTCCTCGAACACATTGTCAAATTGCTCCCACATGTTGATGACTACAGACGGGAATGGTGGTACCACATTTGCAATGTCGTCACGA
GCTGCATCGAGCGCAGCGATTTCATCGTCGTGCTGACTTGCACGCTTCCGAGGAGTGTATTCAGGGCGCAGCTGCTCCCCAACTTCGTCGCCACCCTGCA
GTTGTTCGGATTTGTCGTCGCCGTCGCTTCCGTCAGCAGGTTTGGGTTCAAAGCGTCGACCCTCCGCGGAATCCTTCATCACGTATGGCTCTCCGCCCTC
ATTAGCGTCAAAACAATCAACCGCTGATTTCGCCTGCTGCTTCTTCGCCAGGGGAGAAGCGACGCTTCTTCGTTGGCATCCTGGATGCTGCTAATTATCA
GCATGCAATGGGTTAGTTAGTAAATCAACCATACCTTAAAGCAACCATGACCTTAAAGCAACCTTAATACCTGACATGGCTCCGCGACGGCTGCTGCCGA
CCTTCCGACCTTTAGATCTGCGAGCCTTCCCTGCTACATGCACGCCACCAAAACATAACGCGTCGTCATCAGCAACTGATAGCCATACAACCGGTCGATA
TCGCCCACATACCTGGTGTTCGTTCAGCGTCGCCCTCGTCAAAAGAAAACAGCTCGTCCTCTTCTGACTCATCGTCTTCTTCCATTATGTAGTCGTCGTC
GCTGCTGTCATCCTTCTCGATGCCAAGCGTGGCGTACATGTAGTTCAGCGTCATCTTCTTAGGTTTCTTGCGCAGACGCTGCCCTTCAACAGACACAAAC
GTACACCCACAAAACATTCAGTGATATGCGTGCACCTCTACATGCCAGCAGCGTTACCCTTACCGTGTGGGTCCTCCCCCTTTGCTGGCACCATGTGTCG
TCTTGTGTAGCGCGGTATTTGCGCTTCGTCCGGTGCTCCGCGTTCTGTACGTCTCGAGATCCTCACTGCCGCGCAAATTCTAGAATGGACGGCTCTGAGA
GCTCCAATTTCGTACTTAGGGAATCGCACTTAATGCTTTATTTCAGCAATTGAATTTTGGGATTATATATTACGGCAGAATTTTTGAAATTCGTCTAAAG
CGACTTTACACTGCCAAAAGCGACCCTACATGTCTCACCATTAAGGTCGCGGTAACCACTCCGGAAAATCCTGCGGGAATCGGCCCAATACCGGTACACG
TAGCAGTAGATTCAAGGGTGATGGCTAATATGTAGGTAGTACTAAACCAAATTACTTTATTGAAATAGTAGTACAGATAGTATAATGTTATTACTACTGA
CAATGTGTCTTTCCAGCCGAATTAACCTACCAGCGCTGAAACGGTGCCGTGGTAGAGGCACCACCAACGCAAGAGCGGCTCTTGATACCCGCTGTGTTGA
CACGATATATACGTCAGGAGCCCCAACCGGGGGGGGGGGGGGGGGCAGTCTGTAATAGTCTGGATCAAGAAATGTCGCTCGCTTTTCTTGAGAACCGAAG
TTGAAGTCTGCAATTATTCCCGTTGAAGCCGAAAGATGAATACATGCATGCATCCTCTTCCTCCTCAGCGATTCCTCACACATTCGTGTGTGGGGTCGCA
CGGACCACCTGGCAAGTCCTTTGCATTCCCACCTCGTCATCAGCAGGTGGCAGCTTTTTTTTCATCTTGCCACATCAGCTGCTCGACTATTAATACACGA
ATGCCTCCAGGACTGCCCTCTACTGTAGAGTCTACACCACCGGGTAAGACAATAGCTTGAGTTCAAATCGCGAAGCGTCTCCCGTCCACAAACTCGCGCA
CGAGGTGATCCCTGGCACAATTGACGCAATGCGAGAACCTCATCATACGTGTAAACTGTACAGATACATGTATTTACATGTACTGTAGCCCACTGCCTAA
AAGCTTCTTTGTGTCGGTGCAATCGAACGAGCGTGAGCAAAATCGCCATGCAAAGTCTGGCAGTTCGACGTAAATGAGCGACCACCTATGGCTCTCGGCA
ATCGGTTCGGCCAATTACATGTACGTGGCGCCTCTGCCGGCTGCCGTCTTGTCGAAACCCGCCTTCCATGATATCCCACTCCCGCCATCACATATCCGAC
TCCCTCCACTATCCAATCACCTTCAGTTATCTATTTTCCACACAACCCGACTCATCCCTATAAAGAGGATCCACTATCACAGTTGGCATCCAAGCTGACT
TGTTCTGACTCTTCTCTATTCCAACAGAAGCTGCACTTTCCGATCCATTCAGCCGAGCAGCTCCATTCCTCGGTACGCTACGCTTCACTTGCGCTCTGAC
CGCCTTAGGGACATGGCGCTCTCGGCGGTGGACGATGAGCAGCAGGCTCGGCTCTGTGGCCGCGCGCGCGCCAAGGAGGTCTTCCAGCCCATGCGCTGGA
AACGCATCGGGGCGTTGGCCG