Description :
From Genome Similarity Track
Location :
scaffold_220:39373- 40722
Transcript NameFunction/comments
g5867.t1 methyltransferase

Sequence
1349 bases(100 bases per row)
GAGCTGCTGCCGCGCAGGGCGGAGGACTTCCGCAAGCAGGAATACTGGGACCAGTTCTTCCAGAAGCGAGGCGAGAAGGCCTTCGAGTGGTACGGCGACT
ATGCGTCTCTGCGTCCAGGACTGCAGGCGCTGCTGGGGCTTCCGAATGACGCGCCATCGTCTCTCCTCCGTCGCCTCAAGGCCAAGGTCCGTGTACTGGT
CGTGGGCTGCGGTAACTCCGCGTTGAGTGCGGATCTAGCAGCCGACGGCTTCTCCAGCCTCTTGAGTGTGGACTTCAGCGAGCGCGTCATCGACGAGATG
CGGCGCAAACACCCGGCGCTGCAGTGGCAGGTGATGGACATGACGGACATGCGCGCGCTGGAGAGCGGCAGCTTCGACCTGGTGATGGACAAAGGCGCGA
TCGACGCGCTGATGGCTGAGGACACGGCTGAGATCAAACAGGACGCGACCAAGATGCTCCGCGAGGTGCGGCGCGTGCTGGCGCCCGGCGGTCGCTACTG
CTGCGTCACAATGGCGCAAGATTTCATCCTGCAGCATGTGCTGAGCTTCTTCAGTCTCAAGGATGAGCAGGAGGTGGAACCTACGAGCTGGAGTGTGGGT
GTGCAGGAGCTGCCGCGTGACGCGCGCAAACCTTTCGCTCCGTTCCTTGTGGCAGCTCTGAAATGCCCCAAGGACAACAAGGCGGCCATGGAGGCGCAGT
ACAACGCTAAGCAGTTTGTTAGCGATGCGGGCGAGGCCAGGCAACAGTGGATCATTCACGAAGTAGAAGCCACGCAATGGTTCGCCATGACGCAGGCGGC
TCTGCGACAGCTGAAAGTTGGACGACAGGAGGTCATCGAGCTCATTGCCAACGACGAGAAGGACGCGACCAAGGGCGTGGAACAGAACCAAGGGGTGGCT
GCTCAGGTAAACCCTCGGTTTACGCTGCGTCTGGTTGATGCCCACGCACGTGGGCCCAATGGTAGCTGTGCCGTGTTTCTGATCCCGCAGGGTCGTGAGC
ACGAGTGGATGTTTTCGACCGAGGAAGGTGCGAACGAGCTCGCTGCTGGAGCTGGATTCAGTCGCCTTATTATCGTTGCTCTTGGCCGTGGCGGGCACGC
CTTTGAGAGCACTACCAAGGTGCAGGAGGAGTTGAATGCCAAGGTGATGGAGCTGGCCCCTGACACGCTTGGCTCGGATGAGAAGATTCCGTACCTGACT
GTGGAGGAAGGTCTTGGTGCTCGTAACATTGTGCACCAGGGAACATCGCCGCTCAGCGGCGCTTTCTTTGTGGAGGAAGTGCAGGAGGATAATGAAACGC
TCCGTCGCCTAGTATTCCTCAGCAACACCAATGTCATCCAGAGTGAGGT