Description :
From Genome Similarity Track
Location :
contig_22:393714- 398088
Transcript NameFunction/comments
g5642.t1hypothetical protein

Sequence
4374 bases(100 bases per row)
TACGAATACGCCCGACTGCCGCCTCCTGTACCAGGCGGACACTGGTAATCCTGCGGCAGCATGTAGTTCTGCAGCGCACTGAAGCAATACTGTGCCTTGC
CAATGTTCTTCCGTGCATTCTCGCGCCGGACCCCGTATGTGCGAAGCAAGTTGGTGAACGCTTCCCCATCATCTGCAAGGAGTCCGTGGGAGCGCACAAG
AAGGTTGGCTTCTTCGAGCGTGATCGACATCGAAGTGCGATCTTTGGCCGATTTGCACATCGTCACTCGACCGCCGCCAACGGAGCGCGCAATGGACGAC
GACAAACTCAGGATAGACATACGCTTGGATCGCCCTGATAGCTGAATGCCGACCTTGAGAGCCATGAGAGACGTTTGAATCCGATCTAGGTCCTCCGCAT
CGTAAATGGCAGCTGATTCCTCATCTCTGCTCTGTTTCTTGGACACCCATTCAGCAAACCTGTCCACATACGCCTCCAGCTCGACCACGTTCTCTGCGTT
TATCTCCTTTTGTAAAGAAGACTTGCCAACAGTATTAGCGACCGTCTGCATTTCATTCAGCCCTTGTGAAAAGATCACTGGCACCACGCAGATGGGTTTC
TGGAAAATAAACTTGGCGCGCATCTTCTGCTCCGGCGTTGATAGCGGCAAATAAATTGCCCCTGAGATCGCGTCCTGGCCGGAACCCGGTGCATGCTCCG
ATCCGGAAACTCGCTCCCACGACGCGTGATGATAGGGAGCTCGATCACGATACCCGATGGCCCAGAAGTGATTGAGACGCGAAAAGAAGCAGCGCGTGGT
GACTTCACAGGTCTCAGCTTGATGTGGATACGTCCGAGCTCCTTTACGGCAGCTTCCGTGTCGCCCAACATCCCCAACTCGTTGCCATATGTAGAGAGTA
AGCTTTCCACCGAAAACAAGAAGCCAACCCTTGTAAGCATTTCCAAGTAGTCGATGCCGCAAGCCTTCAGCGGATGGGGACCGAAATCCAAGTGGTCGTG
CGCATGGACGTACAGCGTTTGTTGGAAGCACGTGACGAGGGCACTCATCGCTTGGCAGAACGCTACCTCGAGCCGACGCTCCACATCCCATTTGAGCTCG
TTATACTTGCGCTCCAACGCGTCCATTGTGAGATCCGAGCTCGCCTGTGCTTCACAAGCCGCCCATGAAGCCTCTCTAACTCTTCACGCATCTGACGAAC
GCCGCCACTCTTGAATCCGTATACATGTGCTGCAAAAGCACCGACGTCGTCGTGCCGTACATCCGATGCTTGTGAAAAGGAACTCGGCCTCTAGCCCTCG
TGTTAATCGACAGCGAAGGGTTTTTCGACTGCGCGCTCGAAACTGAGCCCTCTGGAGACCCATCACCATCGTTGGTTGATACGGCCCGCTTCACTTCTTC
GGCATCAACACTGATTGGTGCTACGTCAGCAATGACATCCGTCGTCATATCCGACGAGTCAACAGTATCATCAATGCCATAGATACTCTCGAATTCCTCC
TCAGTAATTCCCATCGCCACAATGGTTTCTGCCAGCTTTCGTTGCTCAGAAGGAACAGAAATGGCTTGGCCTGAAGCTCCCTTGTTGACAATAGTCTCAG
CAGAGTCAAATGATATCACGCGCCGACGGAGGGCCTCTACAGGCTCAAGAGGCGATTCTTCGGAGGGTGGAGAAAATACGATCTCTTTCTCGTCGTTGAT
ATCATCATCGATGAACTGCACGGAATCGAGGTCAGTCTGCTGTCCGCGCACGCTGGATTCTCTCGACAAGTGCAATGGTGACGACATTAGCGTCCCGACA
AATGAATTCACAAGACGGGCGTAGCGCGCCGCGCTAGTTTGGTCGCCGTATTGGACGTCTTTTTCAGACGTAGGGGCTGCATTACCCACAGTCATCAATT
GCTGATGAAGATTCAACGCCAGGAAACGTAGATCCGCGTCTGCTTTCATAGTGCTTGGTTTGAAAGTGAGCCCCGCATGCTGCGTAGTTCCGTACCGTAA
AATCGAGTCTTCTACCTCCGATATGTACTGCTCCATTGTTTTGACAAGATCCAGACGCCACTTTCGCTTTTTGCGCTCAATGGCGTCATCTTGAATCTGA
ATGATCATCTCCGACAGCATTCCGACGCTGGTTGCCGGCCTAACTCGGTTCTCAAATTGAAGCGAAGAGCTCATTCCGGATGCACCAGATCGCAGCGATT
CTGAGTCTTCCGACGACTGTGTCATGTTAGTCCTATCATGCTCTTGCACAGTGCCGAGGGCTCTCGGAGAGGAAGGAATCGCTGAGGGTAGTGAATAACC
ACCGACGCTTGGGGTTGACAATTGACTGGAGGGGGTCGACGATGAGCTTTCATCTCCATCCTCAGCCGCAATTTCGCGCTTTAGCGAGTCAAGTTTGACC
AGCAAGTCAGACAAGATCAACTGGAGCAATTGATAAGGTACCTCCCAAGTGTACACACTTTCGATCAGCTCTTCTTCGACCAGCATTTTTCCTTGTGAGC
GTTGGGAGGTGGATGCAAGATTGATCATCTGCTGAGCAATCTCCGAGTACGTTGAATCATCGCGGGGCGAGACATCATCTGCATCGGTATTGTTAATTCC
GATATACATGAATGATCGAGTGATGCGCTCGAGCCCGCCACAGACATTCCGGCGTGTAAACCTTTTACCTCCGCTTCGCAGCGAATAACGATTTCACCTG
AGGATTGCGTCCGAGATAGCGGGGAATACAGCGAAAAAATGGACGCCCGTCCGATTGGGGGTGTTGAGCCCGTCATAAATGACGAAAGCGGAACAAGCGG
GTCTCCGACAAGCCACTGGCTATTCAGGTCCTCCAATGAGTTCTCATTTCGAACCGAGTACACCGAGGCGCGGAGCAAATCCTGCTCGCGCATTTCAACG
GCCACCATCATGTGGAAACACGGGTCCTCAGAATGCGAGATCTCGGTTCGCCAACCTCGGTCAGTACTGCGCCTGTCTCGGCATTCATAAGGTGTAGCAC
AACAAACGATGATGACGTCAGCGATGATTTCGAGGGCAGCTTCAAATTGAAGCACTGAAACGATAACCACGCGCACGGCACATTTTGTGAAGCAGACCGT
GCTGGCCATCTCGTGTCATCGCTCCATGACCCATCGGACACAGCCACCTGTGTTGCCTGTCGCTCGTACTCGGACGCTGACGGCGAGCCTGCACTGCTCG
TTGAATCAAGCCTTGCAGACCTGCCACTTTGCTGTTGCTGCTCTGAGTTTCCTCCACCCAAATGCTGGCGAACCACAAGCTCCAATCGTCGTTTCGCGCG
GTCCAACACGCTACTTCCAAGCCCCAGGGACAACGGACTTGGGCGTCGACCAACCGTCAAGTACCCTCCCTGTGAGCCCGGAGGCGAGTTGGGTGGCGCC
GCTCGGGCGACGGCATCCCCACGATTCTTGGCTGCTACCAGCAGCGGCCTGGGCAGCACCTCGTTGTCCAGCAGCGGGGTGGCCTCGGACGTGACTCGAC
CGTTGTTGTAGCTCAGGCTCCTGCGCGACGGGATCTCGAGCGTCGGCTCCACTTCCCACATGAGCACCATGAAGAGCACGCAGGGTACGATCTCGGGGAT
GGCGTAGCCCACAATGACGCACACGTCGGGGCTGTGGATGTCTCCACATCCCTGGTGAGAGAAAGGTCGTTGAATGTACATGATTGTCCTTAGTAGGAAG
AGCGCCGAGCACGCCCCCATGACGAGCCCCGTGAAGCGCAGCGCCCGCGTGAGCTTCCGCTCCACCCGCTCGTCCAGTCTGCGTCTCAGGCCGTCGCCCG
AGGGTCGCAGCACACGCTCCACGCGCAGGCGCATCTGCCACGTTGAGTATAGCAGCCCCAGCGAGCTCACGAGGCTGCCCGCGGCGATCAGTAGCACGGG
CAGGACGCCCGTCCAGAGCGTCGTAGCGCGCTTAAGCCGCTGGTGCTTGCTGCGGGCTTCGGCCACCGCAGCCTCGTGCAGCAGTGAGAGCCCCAGCACG
AAGGCATAGAACAGCCCGTTTGCCAGCACGAAGGCCACCCAGATGCGTCTCGAGCGGCGCGAGACCTTCGGGTTGGCGATGTCGATCCACCAGAGCGTCT
GGAAGAGCACGAGGCTGAAGAACAGGCACAGCGCCGCGCGGTTCAGCACGTTGCGCAGTACGCCCTGGCTCACGAATGACGCGGCCCGGAACAACGCAAA
GAGCACCATGAGCCGCTGGAACGTGCTGCGCTGGAAAGAAGTGGCCTGCGCGCGGCACGCGGCCACGAGGGCCAGAGACACGTACAGCGCCACGCACAGC
AACTCGAGCGCCGAGGACGCGCGCGGCAGGAACACGAGGCCGTCATCCACGTCGGAGGGGGAGGCCATGGGCGC