Description :
From Genome Similarity Track
Location :
Scaffold_1476:3937- 5406
Transcript NameFunction/comments
Phyag_g10739hypothetical protein PHYSODRAFT_347717

Sequence
1469 bases(100 bases per row)
CGTGCACGGCGGTGTAGTTGTAGTATACCTCGTTCTCGTACTCGCTATCGCAATAGGGGAACTTGGTGTCCGAGTCCGTGGGTGCGAACAGCGTCTTCCC
GGATGTGTACGTCACGTAGCAGCCCAGGAAGCTGcacacgaccacgacgacgagcgccgGGATCTTCTCGTACAGCGGGAGCTCGTGccacagcttcttg
agcaggaagATAATGGGCAGCAGGATACTGATGAGCGTGATGCAGGACGCGCCCACGAAGTCCACCAGGTCGGAGAAGTGGTCCTTGAGGATGATCGACA
GGATGACCAGCACCGCGATGATGGCGACACGGAGGATCACGTACTTGATGGCGTTCGCGCCGCGGTACTCTTGCGACTCCGCCTCGACGTCGCCGTAGTA
CGGGttctcggcgtcggcgttCGAGATGTACGACATCTTGGATGAGCGACGGTCGTCCCCGTTGACGGCCTCCTTGCCCGGCGTGTGTGCGGCAGCGTAC
GAGGCAGCGGCGGCGTAGGAGATGGcgttctccacgtcgtcctccttcttctggtgCATCTTGAGGACGAGGCGCTCGGCGAGGTAGAAGGCCGGGTTGA
GGATGACCGAGAAGGCGATCGTAATGTGCagctgcatgaagaagtaGGCCATGACGACGGCGCCCCAGTCCGACTTGAAGCCAAGCGTGGTGAGGCCGCT
CGTCTCGTCCGGGTAGATGGAGTAGAGCAGGTTGCCCGTGATCTGGCAGCCCACGGCCGAGTACGCCGTGCTGGcgaggatgaggaagaggcacgagatg
aaggccatcgtgacgaagacgacgcgggGCATGCGAGTCGGCTCActgtgctggcgctgcagggcCGGGATCACAATACCAGCGTTGTACGCGAGCGACA
GGTTGCCGAACATACCCGCGACCTGCGAGAACTTGATGTCGGGCGACGGCGGGGACGGGTGGCCGCGCATGCCGTGCAtgacgacggccacgccGATGAC
GTCGGCGATGAGTGTGCCCGCGCAGCCGGCGAAGGCCGCGCCGGCGCCTTCCTTGAGCGTCGGGATGAGGCATACGGGCAGACACATGAGCGCcatgaag
cagatccagtACGAGGCACTGAAGGCGTCCGGGAACAGGCCGTCCAGCAGAGTGCCGCCCAACACGAGGAACACGCAGGGCACGAGCAGACACGAGGCCA
TCTGCGAGACAACCGAGAGCCAACGGCCCCACTTGCCCATGCACCACTCGCCCAGGTCGCTGTAAGTTTTGACGCTCTTGggcgccagcagcatcacacg
GCAGATGGCCACAGACGCGTACACGTTGGCGAAGGCCATGAAGGCCATGCCAATGACGGCCAGCACTGGCCCGGCACGCGAGAAGTTACCAGGCATACCG
AGCGTTCCAATGCCgtagacgcagcagaagatgtTGAGCGCCATCTTGAGGTCCTCCATGGTgaggaac