Description :
From Genome Similarity Track
Location :
contig_27:39368- 40399
Transcript NameFunction/comments
g6935.t1XP_009534308.1 hypothetical protein PHYSODRAFT_523237 [Phytophthora sojae

Sequence
1031 bases(100 bases per row)
TGCGCAGCGATTGACCCCCAAAAAAATTACTCCGGATATATATATATATATATATATTCTGTCTGGTATAGAATATTGGTTTGAAAGGGGTAATACTGAC
AGGGAAAATATAACTTTGAATATCTTACGAAAAGTGGCAGGATTTCCTTAAAATAATATTTTAAGGAAATTCTAAAAATATTATTATTGTTTAGGGGGGA
TTGCTTTAAAAAAATTAAGCTCGAAATTCAAGTTTTATTTTAATTCGTATTAAAATACTGTAGCTTTAATAATAATTCAACGACAATGTGGCAGGTGGAC
GAGCTGCATGTGAAGCAGCAGCTCCGAGAGCAGCAGCGGGCGTGGTACGTTTCCCTTCTTCTCTCCAGCGCTATGCATCCATCCTCACTGCGCCCATTAG
GGAAGCAGAAGAGATCGCTGCCGGTTGCTCCGATCCCCCGTCGCTTCAGTTTTGGAGTATTGGGAAGTTGCTGCGCGTGCTTCGAGAGTCTAAATCCGCT
GCAAATCCGCTAGAAACTCTGGCTGAGCGAGGAATTACGCGGTACTCGGTTGGCAGTTGTGACCAGCGCCGATGGGCGTCGCAGTCCACAGCAGTAGAGA
CGCAGCACTTCCCTACTGCGGACGCTGTGACCTACACGTCCAGTCACATTTGGCTCACGGGATTTCTGCATTTCGGAGAGGAATTGGACACTTGCGATAC
ATTTTTTTTATGTGATAGCAACTCCAAACTGCCGAGTTTCCTACTGGACCCCAACCCCCAGTTGACGACGGATCAGTTGGTGCTCGTGAAGCGCTGGGTG
CTGGTAGATAAGACGATCGGCGGGGTTAGAACCGCGTATTCAATGTTTCTAGAGGTCCACGATGCAAAACCCATGGCGCTGTTACCGGTGACCTATCCGT
ACGCAGATTGGACGCAGGAGGACGTGATTGCGGTGCTTGAAGCTAATTACCAGACGAAAGACCCGCCGATGTATTCCGGCACGGAACCATGGGGTGCAGT
TGCAGCGCTATCGAGAAGAAGTGAGGCTGAT