Description :
From Genome Similarity Track
Location :
contig_8:393632- 395058
Transcript NameFunction/comments
g1626.t1hypothetical protein

Sequence
1426 bases(100 bases per row)
AACTCACATTCAGTCTCGCATTCAGATCCAAATGTCCACCTTGAGCTGCGTGAGGCACCCACAGCATCAAGGACCCACCCCCGGTGCCCGGAAGACCCAG
GAAACCCGGACGCCAGCGATCCAGATACAAAGTCCGGCCACCCATCGCTGTGACGTTGGACTTCCACTGGGCTTTGCCGCCTGCAGCGACGTCCACTTCG
TCGACTTTGTCTCCTCCAGAAAAGATATTCACTGTGACATTCTTGGTATCGTAGCTGGTGAAGTTGATGATGACTTGGCCGTCTCCTTTTTTCGTCCACA
GCATGGTACTGTTCTGAAAGGCCTTCTGGATGGTGTTCAGGCCGAGAGTGTCGGGGTCTGTGCCGTCGTCGATCTCGCCCATGAACTGCGTGGGACCGCA
AATGGACTGGAAGTACTCGGAGATGAAACTCGAGACACCACTCATATCGAAGCCCGTGACGACCCACATGTTGAGACCCTGGTTCACCACCTTTACGCGT
ACTCCTTGGCCTTGTAGGACGTGCCGTTGTCGCTCTTGCCGGTTGTGATGAGGTCGTTAATGATGACACCGAACGTCTTGCGGAGCTTGTCACGCGTCGT
GTAGGCGGTATCCTCGTCGGACTGGGAGATCATCAACTCCATGCAGTTACTGGTCACCATGGCGATATCCGTCTTCACGAGATCCGTGTCCTGGATCTTC
ACTCGCAGCTCGTCCTCCGTGATAGCAGGGTTCTGCTCCCTGAGGGCCTCAACCGTAGCCCACGTGCGTTCGACCAGTCCCTGCAAGTCGTGGCCGCACG
TCGAGTTGGATTTCAGCGCATCTTTGAGGTATCCGATCTCTCCCTTGGTGATCATCGCGGGAGGGGCCGTGAAGTTAGCTCCCTTGAGAAAGCCGTGAAT
GAACTCCAGCTAGTAACGAGCTCGTCGTCATGGGCCAGGATCTGGGACAGGATGAACTGGGTAGACCCATGATTCGGTCGGCCAGCCACCACATGGGTCC
TGCCTTTCCACCCAAACACATTTGATAGTATGGGCAGCTCATACAACAGCGTTCGACTGGTACAGCAACGCCAGGATCTTGTCTTGCGAGGCTTGCGGGT
CCGCAGTTTTGATCGACGTAGCGAAGAATGGCTCGGATCTCACCGACCATCATGCAAGAGCACATGACGGCAATTCGGACCCTTTGGCCATCTCCGAGAA
CTTGCCGAACCAGTTGTCCATGACGCCGTTGATTCCGACGTTGAAGACGGAGCTGACCTTGTAGAAGATCTCGCGACCGCAGTCGTCGTTCTGGCGGATG
CATTCCATGCCACATTCAACCGGGACTCGATCGGACACTCCGCCAACAAGTGTTAGTTGCCTCGTTGCGGTCGTACCCGCTCGGGCACACGTCCATGATG
TGGGCTTCGCGGTAGCACGCACTGTC