Description :
From Genome Similarity Track
Location :
Scaffold_25:393543- 396523
Sequence
2980 bases(100 bases per row)
TCGATCTTATTTTCAGGCACCACGGCTTTTCTGAATCCATTGTTTCGAACCGTGAACCGCATTTCACGTCGACTTTTTGGGCAAAGTTGTTTCAACTATT
GGGCACGCGATTGCTTATGTCTACGGCAGCCATCCAAAGATGGATGGGCCAACGGAGTGCGTGAACAGAGTGCTTGAAGATGTCCTGCGCAGTTATTCGA
CATCGTTTGATTCGTGGAGTTCATTTCTCACACTAGCTGAATGTGCATGAAAAATGCAGTCCATGCGTCAACAGGCTTGACGCCATTTTCGTGACAACGC
GAGGCACCCTCAATTCCAGCGCTTCTTGCTCTTTCAGCTTCAGAGCACCCCTTTTCTAAGCTTGATGGGGGAGTATCTGCCGATGGCATTACGCCAAAAA
TTTGATGATTGATTACGTTGAAGACAAAGTTGCTGTCGATGCAACTTATGCTGTTAATTTTGTGGCCAATGGCATATCGACTCCCGACGCGATGCATCCT
GTCGCGTCTCCCGTTGCTAGTTTTGCTCCTAAAGAGTCCACTGCACCTGTAAGTTCGTCTGCTGTGACGGAATTCCTATTAGTACGACAAGGCATCACGC
GTTTTGTACGTGATGCCCTTCAACAAGCAATGGATTAACTAAATGATAACGCTGACAAAAGAAGTCGAAAGAACACGTGGACGTTCAAAGAAGGTGACAG
AGTCTTGTTTATCGACAAGTGGATTACCAGACATATCTATGACGAACTTGGGCGTTAATAAATTACCGCCAAGATATATTGGTCCCTTTCGGGTTGTTCA
GGCACATGGAGATACTTACACGCTAGACATACCTACCACTATGCGTCTGCACCCGACGATATATGTCAGGCGGCTTAAGGCTTGCTGGTGGATCTTCACT
CAAACCTTCCCGCTCTTCAGTGTGTCGGTTCGAAGCCGAAATCTCATGTCGATGAAGCTGACGACGACCGGGACCAAGTTCTACCCGAGCCCGTCCAGAC
TCGTTTTGCTGGGGTCAACCAAAAGCAGCAGTCTCAAGCTGACGTAGACGCTCCGCCCAACCCCTACTGCTCCTGTCGAGTCCTCACGGCAGCCTCCGTC
GCAGCTGGTGCACGATCGCGAGTACTCTCGGCCATCTCACGAGCATTCAGTAGGCCATTTTTCGCCTCTTCAGTGTTATCACAAATAAAACGCAGCTCGT
CGTTCGGCGGCACAGGCGCCCGATTATGCGAATTGGCGCCCAACCCATGAGACTTTTCGTCGTGATGCTCCACTTTCTTTGGTGGATGCATCGGGTGAGC
GACGTTAGATTGTGGACCGTATCGTAGGTCATGATAACACCACGCCTCTTGCGTCGAGTAGTGACTAGGCGCCATCAAAAATTCGAGCCGAGACACATTA
TAAAGTCCGCTGGTTCGGTTATTTACCAACGGATGACACTTTGGAGCCTCGAAGTGTGATGGCTCGCGATGTTCCTGAAGTCGTTGAAAAGTATGAGACC
AATAAGAGGTCGGCGAACGCGACCGACGCTGTCGATCCCTCACATGATCTCGCGAGCCGTGACGCTCGCAAGCTTGCGATCGACGACGGCTTCCTGAGCG
ACTCCAACGTCTACTACGAGGCTAGGGAGCAGTTGGACATCTGGACGATCGAGAGCGACTACGGGAACGACCCCAGAGGCCGTCTGTCAATCGATCACGG
CTGCGTGAACGCCTCCACTGATCGACAGTGCGTTCTCTCATGTGGCGCAGCGCAGATACTTGGAGCTCTGAGAGGCTCCTCTCATAGCGGCCAATCCATG
GTCGGATGTGCTGGGGCATTCCCCGTGCACACACCACGTCGTCCATACCTGCTGTATTGGGAGCGGTCTCTCCCCGTAGCTCGGTGGGCACCCTTCAAGG
ACATGAACGTAACACATGTAAAACTCGTCACGAGTCAGATGACATATACGTCGGCGTAAATTCCCAATAGCGTGTACACCAGAAGTGTCTTCGTGCCGCA
TGATCCAGGACATAAAGGATGTTCCTTCACGTCGAATCGCGCTCCAACTCCTAATGAAAGCGCTCCAAGATCGTTGCAGTACGTCTTCACTGTATGCTTG
ATTCGTTCCTTTGCCTCGCACGGTACAGTATCGTGTGAAGAGGTTGTTCATCGACTCAAGTGATTCAGGTAGTTCAGCACCGTCGAGGCTGTACAAGCTT
CACGGCTTGTACAGCCTCGACGGTGCTCGAGTATCGCGTCGCGTGGGTGTCCATGATTCATGCTGTTCAGTTGTGAGTATCTGAGCAGATTCGAAGACCA
AGATAACATGCCGTTGGAGTTCTCGTTGGGCTTCCCGTCGGACTACTTGTTTTAAAAAACCTTTCTGTGTATGGCGCTTTCATCACGGTAAGCGCAACTT
AAAGAGGGAGGTGATGTAATGGGAAAACCAATTATATTAGGTAGTCATAGGTTATTACATAATTGCATATATTAAGTATAGGCAGTATCCGGATAGCGGA
TACTGCGCATCTATTTATTATTGGTTTATTATTGAGGTGCCGGACCCAATAATTAGCCAATAGTAAATAGATCTATATTTGAGTGATTTCCATGAGCTAG
GGAGAATATTCGCACATATTGCAAATTTGAAAACACAAAATAAAACAGGGTTGTAATTACCTTATAAATAAGAGCACTTCCTCACGCACTTTAGAGTGTA
AGACGGTAGCGGGGCTCTCACCCCGTTACAGCACCAAATATGACCGCTAGAGGGCCGCATGCCGAGTGCTGACGGATATGGTGCAACAAACTAATAAAAA
TCTTGTTGAATTCCGTTCCGTACGTTTCAACGAAAAGAGTATCTGTTTCTTCACACTTTTATGTATATGTGGAGTTAGCACTTTATTCACATCGATGTCT
TTTGTGAGCTGTCATTATCTCTTGAGATCTCCACAACCAGCGTGCTGTCCTTGGAGTTTAAAATCATTCACAGCACCAAC