Description :
From Genome Similarity Track
Location :
Scaffold_63:39350- 40528
Transcript NameFunction/comments
Phyag_g1442hypothetical protein

Sequence
1178 bases(100 bases per row)
GCTTCTTTTCATCTTTTCCACCCGTGAGTACTACAGTATGATAAAACCCCGCAGCAACCAGGGCAACTCGCTTCCCTACAAAATCATCGATAGGGAACGG
ATAGACCCGTTCATTCGTGTCGCCCGTTCCCAATTGTCCATGGTTATTTCGACCAAAAACGTACATCACTCCGTTGTCCGACACAGCCACCGTGTGGTAG
CATCCACAGGCAAAGCGAACAATATCCTTGCCTTCTAACTCCTCAATCAACCTTGCATACGAAaatcgttgctgttggagctgcaaaTTAGTAGTTGAAC
TAGAATTGGGTCGGGCAAGTCCAAGTTGGCCGTAGTCGTTGCGACCAAATCCAAATAAATGTGCTCCACTGCAAAGAACGATACTGTGGTAGTAACCACA
ACGAATTTCCAGAcactcctgcttctccaaccCAGCTCTCACCTGCACAGGAACCAATTGATTCTCCATAGAATCCATTCCTAGCTGACCATAGTCATTT
TTACCAAATGCAAATGCTTTGCCAGTAGCCGTCACAACTATTGTATGGTACTGCCCGCACGCAACAGATACAGCGTGTTGATCGTTCAACGCTTCAACAC
GCTGCGGGACCTTGCGATCAATAGAGTCATTGTGGCCAAGTTGTCCATAGTCATTCCGCCCAAATGTATACAGGAATTGTTGGTCACCGCCATCCTCTTC
ACATGCCATAACCGTGTGGTAATAACTGCACGATACCAGTCGTACAATTCTGTTTTCCAGGCTCCGTACAATCTTCGGCACGCTCTCACTCGCAGTATTT
CCATGGCCGAGTTGCCCTCGATAATTGTAGccgcaagttgctgctcgacCATCCATTGTAACCAAAATTGTGTGTTCACATCCGTTGTAAGCGTGTACTT
GCGAAATAGCAGTCTCCCCCAACTTTGGTATCTCGCTCAAGTGACTAACTCGAGCAGTTCCCCCTTGGCCACACTGGCCGTTATCGTTATACCCGCAGGT
GAGGACTTTGCCATCACCTGTCAGTGCTATGGTGTGCTCATTGCCAGCGCCAATCTGGACAATTTCTTTGTGCTGAAGAGACTCAATCCTCTCGAAGGAT
TTACGCGATGCAGTATCTCCATGTCCAAGCTCTCCGTACGAGTTCTGTCCACAACTCCAAACTTCTCGGTccccttcc