Description :
From Genome Similarity Track
Location :
Scaffold_90:39345- 40900
Transcript NameFunction/comments
Phyin_T30-4PITG_19198Putative uncharacterized protein

Sequence
1555 bases(100 bases per row)
GGATAGCGGATCCCGCAGTGCCGTCTCCAGATCCGAGCGCGCCAGCAACTTGCTTGGTCGGCGTCGAGTGAGATCTCCGCCGAGCTTCAGATCTGGACTG
CGACAAAGCCCGCCGCATGTCTTCCTCCAAAGCATCGTCGGCGATTCAGGCCTCCTCGGAATCCTCAGGATCCTCATCATTATCGTCGGCATCATCGTCG
GGGCTGAACGAATAGTGGCCCGCGGAGAGGGTACGCTTCAAAGACGAACGGATAGGAGGTCCCGAGCCGTCGGACCAATCGGATACTTCGTCCTCGTCGT
CTTCCGAGCTGCCGAGTCCACAGCCGATGGGAATGGTACGGTTGACCTTCGCCTTACCGGACCCAGATCCCACCGGTCAAGATCCAGTGGAGGCTGGTCG
GGAGACGGTAGACACCGCCACGGATGGTCCAGCAGTGGATCCCGACGGAGCCGAACACACGTCACAAGTATGGCGATAAATGAGTGTAATACATGTTGTT
CATGCATTCATCCGATAGTTTGTTGACATCTTCACCAGGAACCTATACTTGTCTGGTGAACAACAGGCCAGTAGGGCGAGTTGGTGATAGTTGGTGAAAA
GTTAGTGAATAGTTGATGAAAATCTATATTTAGACAAAAAGTGCAATACCAGTGTGATACCGGTATTGGAAAACCACATGTTTTGATGGCTTCGCCCGGT
CTATTTGGTCTACCCATCATGATCCGGTTGAGCGGTCGTCTCGCTAAAACTGCTCCTTAACCTTAGAAACGGGTAAACCTATTCTCCTTGTTAAATTTTA
ATAATGAAAGAAATCGTTATTGTAAACGGTTACTTGTGCCACTGGAGTCAGCTAGCCTCCTGTTTCCGCTGTTGACTCTGTTGCCGACGAAGACGAAATC
GAGACGCCGAGCTCCCGCGCATCGCTCTTCTCTAACCTCACCACGAGTTCTTTTGTACTGAAGTCGAAAGCCACAGGACTCCATTTGTCATCGGTTGAAG
GCACGCCTGAAGCACCACGCTACAGGAGCAACAACACACAAATAGCTCGCTGGTCAACCACCTATCCGCCCTCGAACCAGTGTGCAGACAACGCACCGTA
ATGGAAAAGGAACGGAATAAACTGGTGACGCTGGTACTCGGGTTAAACACAGGACCAGCGGCGCGACTGATGCTCTCCATGCGTTTCTCGAGCTCCCTCG
TGGTCACTAGCACCCGCCCCACAAAGCGCTGGTCAAAACCACAAGCACATTCAATATTTGCTCCGCCATGATTGTAGATGCAGCCTTCACCTACCTCGAT
GAGGTTCACACGGAGGAAAATGTCCTCGAGTTCATGGCAGTTGTTCAACAGCTCGGTCAGCAGCTGCTCCTGGATCTGCTCCGCGTCCTGCCTCAGTCCG
TCGGCCGCCGCACACGCCTCGTCAATCTTGAACAACGCCAGGCCGACGCGCTCGTCCGCAGTCTGTGTGACCTGCGCGGCCTCGTCCAAAAGCTCCTCAT
AGTCCCCGCACAGAGCCTGGAACGCACGCTTCAAGTCGTCGTCCCCCATGGTGGG