Description :
From Genome Similarity Track
Location :
Scaffold_106:3934- 6420
Sequence
2486 bases(100 bases per row)
GGATGTGTATGCATCCTGCGAGGCAACTCGATCGTGTACGCATTGCCTTTGCGATGTAGTACACGAAACGGGCCGATGTACTTGGGTAGTAGTTTACTAC
TACCCCAACATTAGTACTACGTACTTAGGTAGATTTACCGTAGACAGTAGAACTAAGTCTCTAACATTAAATAGAAGAACGTTTGCTCTTCCATGTTGCC
AGCGTTCCTTTCTGCCGATCCACCGCGTTAGCGATGGAGTCTTGCACGAAACGGACCACTGCTTCTCGTGCCAGCAGGAAACCTTCTTCTGCATCACTTT
GGTTTGTTGCAGTGCGCCTTGTGCGCGCCGCTAGGATGTCATTCTCTTTTTCATCGATGGTGTTCTCATCCTCGCTGGAGGGGGTGTAGTCATTAGTGAT
GCTGAATATACCAGTATCGTCATCCACAACTGGGTCAGCAATAGTGTCGTCACTATTGCTGAGATTATCAGCTTCAATGTCGATTCGATCGACATCGGCA
AAGTTCGCGTCGTCATTTACCTCGACACGTGATGGGCAAAAGCCAAGAGCTAGAACGATTTTTGCTCGAGCGAATCCCCCCCTTGAATTAGAGTCACACT
CTAAATATGTGGGTAGGCGTGGATGGTGTAAGCCATTCACGAAGAATGTTGTATGCATTATCGATGCATGCACGGAGTTGTTGATGGCAAACTCCACCAT
CAGTAAAAATGTGCTTTAATTTGTGAAAGTTTGGACGTATCCTCGAAGTATCTTTCAAGGACGCGGTTGACGCGTTCTGTCTGACTATCGGTCTCGGGAT
GGTCAAAAGTAGACATAGTCAGACGTGTTCCGAGGGATCGGAACACGGAATGTCAAAATGCGGCGGTGAACCGAGGATCTCTATCAAAGACTAGTTTACG
GGGTAGACCGTGGAGTCGGAATGCCGTGTCAATGAAGACACGGGCCCAACCGTGTGCTGAAATTGACTCATTAACTGCAGCAAGATGTACCATCTTGCTG
AATTGGTCTACGAACACAAGAATACCATTATTCTTGTGAGTGTCTTCGGGGAAACCGAAGACGAAGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAT