Description :
From Genome Similarity Track
Location :
Scaffold_106:3934- 5002
Sequence
1068 bases(100 bases per row)
GGATGTGTATGCATCCTGCGAGGCAACTCGATCGTGTACGCATTGCCTTTGCGATGTAGTACACGAAACGGGCCGATGTACTTGGGTAGTAGTTTACTAC
TACCCCAACATTAGTACTACGTACTTAGGTAGATTTACCGTAGACAGTAGAACTAAGTCTCTAACATTAAATAGAAGAACGTTTGCTCTTCCATGTTGCC
AGCGTTCCTTTCTGCCGATCCACCGCGTTAGCGATGGAGTCTTGCACGAAACGGACCACTGCTTCTCGTGCCAGCAGGAAACCTTCTTCTGCATCACTTT
GGTTTGTTGCAGTGCGCCTTGTGCGCGCCGCTAGGATGTCATTCTCTTTTTCATCGATGGTGTTCTCATCCTCGCTGGAGGGGGTGTAGTCATTAGTGAT
GCTGAATATACCAGTATCGTCATCCACAACTGGGTCAGCAATAGTGTCGTCACTATTGCTGAGATTATCAGCTTCAATGTCGATTCGATCGACATCGGCA
AAGTTCGCGTCGTCATTTACCTCGACACGTGATGGGCAAAAGCCAAGAGCTAGAACGATTTTTGCTCGAGCGAATCCCCCCCTTGAATTAGAGTCACACT
CTAAATATGTGGGTAGGCGTGGATGGTGTAAGCCATTCACGAAGAATGTTGTATGCATTATCGATGCATGCACGGAGTTGTTGATGGCAAACTCCACCAT
CAGTAAAAATGTGCTTTAATTTGTGAAAGTTTGGACGTATCCTCGAAGTATCTTTCAAGGACGCGGTTGACGCGTTCTGTCTGACTATCGGTCTCGGGAT
GGTCAAAAGTAGACATAGTCAGACGTGTTCCGAGGGATCGGAACACGGAATGTCAAAATGCGGCGGTGAACCGAGGATCTCTATCAAAGACTAGTTTACG
GGGTAGACCGTGGAGTCGGAATGCCGTGTCAATGAAGACACGGGCCCAACCGTGTGCTGAAATTGACTCATTAACTGCAGCAAGATGTACCATCTTGCTG
AATTGGTCTACGAACACAAGAATACCATTATTCTTGTGAGTGTCTTCGGGGAAACCGAAGACGAAGTC