Description :
From Genome Similarity Track
Location :
contig_27:39335- 40366
Sequence
1031 bases(100 bases per row)
ACGACTTGACCTGCGCAGCGATTGACCCCCAAAAAAATTACTCCGGATATATATATATATATATATATTCTGTCTGGTATAGAATATGGGTTTGAAAGGG
GTAATACTGACAGGGAAAATATAACTTTGAATATCTTACGAAAAGTGGCAGGATTTCCTTAAAATAATATTTTAAGGAAATTCTAAAAATATTATTATTG
TTTAGGGGGGATTGCTTTAAAAAAATTAAGCTCGAAATTCAAGTTTTATTTTAATTCGTATTAAAATACTGTAGCTTTAATAATAATTCAACGACAATGT
GGCAGGTGGACGAGCTGCATGTGAAGCAGCAGCTCCGAGAGCAGCAGCGGGCGTGGTACGTTTCCCTTCTTCTCTCCAGCGCTATGCATCCATCCTCACT
GCGCCCATTAGGGAAGCAGAAGAGATCGCTGCCGGTTGCTCCGATCCCCCGTCGCTTCAGTTTTGGAGTATTGGGAAGTTGCTGCGCGTGCTTCGAGAGT
CTAAATCCGCTGCAAATCCGCTAGAAACTCTGGCTGAGCGAGGAATTACGCGGTACTCGGTTGGCAGTTGTGACCAGCGCCGATGGGCGTCGCAGTCCAC
AGCAGTAGAGACGCAGCACTTCCCTACTGCGGACGCTGTGACCTACACGTCCAGTCACATTTGGCTCACGGGATTTCTGCATTTCGGAGAGGAATTGGAC
ACTTGCGATACATTTTTTTTATGTGATAGCAACTCCAAACTGCCGAGTTTCCTACTGGACCCCAATCCCCAGTTGACGACGGATCAGTTGGTGCTCGTGA
AGCGCTGGGTGCTGGTAGATAAGACGATCGGCGGGGTTAGAACCGCGTGTTCAATGTTTCTAGAGGTCCACGATGCAAAACCCATGGCGCTGTTACCGGT
GACCTATCCGTACGCAGATTGGACGCAGGAGGACGTGATTGCGGTGCTTGAAGCTAATTACCAGACGAAAGACCCGCCGATGTATTCCGGCACGGAGCCA
TGGGGTGCAGTTGCAGCGCTATCGAGAAGAA