Description :
From Genome Similarity Track
Location :
Scaffold_120:39329- 40560
Sequence
1231 bases(100 bases per row)
GGGCTGCAGACCTCAGTGTCGCGTGTCCGTTGTAGACACGCGCGACCGCAATACCAGTAGGGCACCCCGCGCCTACTGGCTCTGCACGTTGTTTTTATTG
TACACGGCGATGCCGGGCAACGCCGCGTTGGCCCCTGGTCGAGTGTACAGGTGCTGTGCACTCACGCACAAAGTGTCCGGTGTACCCACATCGGAAACAC
CGCATTTGTTCCTCAGTATGCTGTTAACTTCCATCGGTGGAAGCATTCGAGGGGTCCATAGGCTCTGGACCTCCCGCTCTCATCATTGGACGTGCCATTC
TCATGTTCGCATACAGCTTAGCTGGCATTAGGCTAAACTCCTGCTGCATCGCAAGAGCAATCGCAGCTTCGAGAGTACTTGGGTACTCTCGAAAGAGATA
GGACTTAACCGACCCATCCTTCCAACGCTTTATGATCGTGAAAACGTTTGTCGCCTCGTCGATCGGATTGGTCACGATGTTGGAGACCGAGTACCGTGCA
TGTTGGGAGTAAGCATGAACCTAATGCCTACGTTGCTGCAGGTCAAGAAACTTCGCTCTCGACCGGAACGCATTCTGAGTGGGCTCAAACGTTTGTCTCG
GCTCCTCCTTTAATGTAGCATACGTCACGTATGATCTATGAGCCGGCGGCGATACGACCAGCACCTTCCTCGTCCGCCAAGACATGACACGGCGAACGCA
ACCTTTGACGGCTCGTCACTGATATGACGATCGTTATGACAGTATCGACTTCGGCAAGCCATCGGAGAAGAGGCTCGCCCTGTTCCCCACATAACCGCTG
ACGTGCAGTTTCAACGACTGCACGCGCGGTGTCGTCCCGAAAGCCACTCTCGTAGTAGCAGAATCGCGCTGCTCGCACACGATGAATCCCAGAGCGACAC
GGTTATGTTCTGTTGGTGACAGCGTATGTGGCATTGTCGCTACGGATGCCTCTCCAATGCCTGTTGACAGTCTTTGGGGATCTTTTCAATTCTTGATCAG
CCAGATGGGGACCGTCTCCACGCACAATGTTCGTGGAAGAAGCACATGCTACGCATGGACGGATTACCGTCCATGCGTTGGCTCCCCGCCGCCCGTTCGT
ATTCCATTCCCGAAAATCGACTTTGGTTTCCTACTTTAGTAAATCTATACTTTTGTTAGGAAGTATAGTTAATCCGGGTGAAAGTGCAACTTACGCTTCC
TCATACACCTGCACGAACGTGTAAGCCGAAG