Description :
From Genome Similarity Track
Location :
Scaffold_625:3932- 8214
Sequence
4282 bases(100 bases per row)
GAGGGAAAAGAAGGGGAGAATCTCCTCCTGTGGATCAGAGAGGTGGAAATGGCCATGACCTCCACTATACTCCTGTCAGAGCAACAGCGAGTTGGGATTG
CTATCTCGAAACTAGGTGGTCGAGCCAGAGAATGGGCTCTCACGTGTATCACGTCGGTAGACGAAGCCTTCTCCCCATGGGATTTGCTATAACAGCAAAT
ATCTGGAGTGTTTGCTCCGCCTAATCAGGCATACCGAGTGAGTTCTCGTTTCTTATCTGCCCGTCAGGGCAAGAAAGAACTATTGGACTATGTCCAGGAA
CTGAGAACTCTAATAGCTGCCATGCAGCTTGATCTCTTACCAGAAATGGTTTTGGTTACCATCTTCATGGAGGGCCTTCGCACGGGCGTGGATCAAATGG
AAGTATCCCGGGTACACCTGACCTCCTTTGAGGCGGCTGTTGATATCGCGTTGAACGCTGAGTTCAACTTTAAGGCAGCCCGTTTTGGCACCCATGGGTA
CAACCCAAACTCGGCGAACTCCTTTAGTTCATTTAATAGGCCGGAGCCTATGGACCTCAGTCTCGCCAAGACAGACGAAGAAGCAGAGCTTCAATCTGTA
GAACAGCATCAAAACATTCGACGATGTCTCACGTGCGGAAGCACAAAGTAATGCGACCTAATTGCCTTTTACGCAGGGCACGCCAGACTACTTCATGCCG
AACTCCCGCCGCTAACCAGAAGTCTAGTACGGTGCGGGAACGTAGACTCCCAGTAGGCGCTGGGCGCCCTGCTGGGGAAGAACTATATTCTATTGAGCCT
ATAGGAGGCAGTGGCGAGCAGAATTTAGCCCCAAGGAGTCCCGTTCACTCTAGCACGGGACGTGAATACAAGACAGGCTTGTTGGTTAAAAAGGCGACTG
TTTGGTGCTTTGACAAACCCTGGTCGATTTTGATCGACTCCGGAGCATCCGGTAATCATGTCAGACGCTGTTCCCTTGAAGATAATCCACAGTATGTTGA
GGCGCTAAAAGCGCACAAGGGTGATACGATCACTGTTCACTTGGCGATAGGAACTCTAGTCACTGCACCCAAAGTTTCTGCGAACTTGGGTGTCAAGTTT
TTCGATTTTAGTAGTATTGAACGCTGTTTAGTCCTTGATTTTATTTAGACTCGAAATATGATCTCATTCTTGGTATGGCTTGGCTTGAGCGCCATGAGTC
ATGAGTCATGAGTCATGGATCGACTGGAGGTCAAATGCAGTAGGCGCCACGCGCACTGCTCCTAGCAGAGTTTTGGATAGTCATGAACCCACCTCTGCTA
GGAATCAGAAGCGTTATTGGCGCGAGCCACTGGATGAAAATGTCATTGTGCTGGACATCGGAATGTCAGAGTTAGTTGATTCTGAAGATGTCAAAGACAT
GAGTATAGAGCAAAGCTCGATATGTGATAGTGAAGCGGCATGTACTCCGCTAAGTGATAGTCATTGTGAGAGCAACGTACTGAATGCTGAAAGCATTGTT
GACCAAGCGTCAAGTCATAGAGGGTTGAACCCTTCATATGAGTGTGGAGTGGCACGAAGTACCTACTGAGTGACGTTGACTGTGATAGCGGCGCGCTGAA
TGTCAATATTGATATTTTTGGTGAAATACCAAGGCATCCCGAGCCCGGATCAGCACGTAAAGTGGCACGTAATCCACGTGATAACGACGTCATGTCCAAT
GACTCGTCATCGGATGTCAACAGTGACGTCAGTTCTAGTTTAGAGCAAATTAAGTTTGGCGATGGTATCGATTAGAGAGATACGAATCACACATCGTGTG
CTGTGTCACAAAGTGATGATGACTGTCAGCTGTATACACTCGTCAATGGAGTGACTGGTGCCTGTGATGGTATAACTATCCTTGAGGCTATGCCCTCGTT
AAGTTCGCTTCTAGAACTCGAAAAGTTTTCGGTCGATGAGTTTGATCACTCACTAAAGAGTGGTGACCTTTCAGAGGTGGTGGTCATTCGACCCGACATC
ATATAGTTGCACTCTTCTTCACTTTTGGATGAAGCCGTTCTGGAGGACACAAAAGCAGCACTCAGTGCGCGTAGTGGGTCATCAATATTGAAAGACCCTC
ATGATCCCTTTTATTCTTAGTCAAGGAATTTCAAGATATGGTGTGCCACGATCCACCCTCGGTTCTACCTCCAGATAGAGGTGTCCGTCATGAAATTGAC
TTAGTTCCTGGGACTAAATGCTATGTCACACGACAGTAGCCCTTGACTAAGGAGAAATGTGATGTCATTGATGACTTCTTCCGTGCTAAGCACGAGGCAG
GAATGGTTCGTGAGAGTAAATCTCCACATTCGACACTGACATTTTGTGTCAAAAAGCCTAACGGCAAGTGGCGTATTGAGCATGCTTATAACAAGCTTAA
TGAGGCTAATATTCCGGCATTGACACCCATTCCTCGAAAGGATGTTCTTCAAAACAACATGGTTGGTTGTACTATGTATAGCGCACTCGACTTGGCTGAT
GGATATTATCAATTGCTCATGCGAGTGAGTGACATTCCGCTTGCAGCAGTGAGCACTCCGAGTGTTATGCGATGGGAATGGCTAGTGATGCCCCAAAGAG
CTGTATAATGCTCTGGCAACATTTAATCGTCTGGCGACGCAAGTTTTCCGCCCATATCGGGATTACGCACGGACTTTGATGACATTTTTGTCAATGTTCG
TGCCGAAAAAGGTCGGTCAGATGTTGAAAATCATATCGGTCATTTGCGAGCCGTGCTCGAGTACATGCGCACTAATAAACTGTACGCCAACGCGTCTAAA
TGTATTTTTGGTTCAGGGGATATTCCTTTCTAGGATGTTTCATTGGTAAGCGCGGCCTTCGAGCGGGTCCCGCTTAGGTCAAAGCCATAGACTGGATGAT
TCATAAGAATCAAAAGGACTTGCGTAAGTGGCTTGGCCTTGCCAATTACTTACACAGATACAGTGAAAATTACGCTGATATGGCCCAGCCATTAAATGAT
CTCGTTAAGAGGGACACCGATTGGCGCTAGGACAACACCCTTGCCGACGCATTTCGGGCAATAAAGGAGAGTCTCCTCCATGCTCCCATTTTGGCGTTGC
CAAATCCTGAGTACCCTTTCAGTGTTGTCTGCAATACATCCGACTTTGCCATTGGCAGCGCTCTAATACAAACAGATGCTGCAGGCCGCTCTCTAGTTAT
CGCCATTGAATCACGTCAGCTGAAAGCTGCTGAAAAGAACCATCCAGTTCATGACAAAGAGCTACTTGCTATGAAGTATGCGCTCGTCAAATTTAGAGTC
CATCTACTTGGATCCAAGCCATTCGTCGTCTATACGTATCATGCATCATTACGCACGGCGACACAGTCGCCTCACCTCTTTCATAGAATGGCTCGGTGGC
TTTCCTTCTTTGCGGAATATAACTTCGAGGTGAAGTATAATCCAGGCAACAAAATGTGTTGGCAGATGCTCGCTCTCTCCGACTTGATTGTGAGCTTGCT
CATGCCACGACTTTGTCGTCTCCTATTGAGGAACTAATTCGTGTGGACTATTCAGGGGTCCTCAATATGTGGCATTGTTTCATGCCCTTGGGAGTGAGGA
ATACAAGGACTCTGACAGTCAATTATCGGCACGCTTGCAGGCCAGCCTGCATCGATATTCCATCGATGATGGCCTCTTCTGCTATCGCACAGATGTAGCG
GATACCGCTCGCATTGTTGTGCCTCACAATGAGGATTTAAAGAACCGAATTCTCTTTGAGGCCCACGATACGGCCCGCAGGGGGAATTTGGGCCGGGAAA
AGACTTATGGCTCTGTGAGTCGACACGACTGGTGGCCCAAAATCTACAAATGGGTGAGCACATACTTGCGTGCACGCGAAACGTGCCAGCGGGTCAAACC
CTCAGAACATTCGGCTGCGCCTCTCGCCAGTTTACCTGTGCCCACGGGGTGTTGGGAGTCCATCAGTATGGATTTTTTGTTTGGTCTTCCCAAAGACTGT
GACGGCAATACGGGAATTGTGGTCTTTTTTGACCGTTTAAGCAAAATGGCTTACTTAGCGGCGGTGCCGGATTCCATCGATGGCAAAGGTACAGCTATGC
TGTTTATCGATCGTGTGTTTCGTTAACGCGGGTCGCCGCTAGCAATCATCTCTGATCGCGACCCTCGCTTCACAGGCAAGTTTTGGACTTCTATCTTCAA
GTTACTTGGTACGCGATTGATCTTCAGTACTTGGTACGCCGATTGAACATGTCCACAGCGGATCATCCGCAGACGGATGGTC