Description :
From Genome Similarity Track
Location :
Scaffold_12:393034- 397212
Sequence
4178 bases(100 bases per row)
CCCAAGTTGTATCTTCATAGCCCACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGTGCTCGTCGTTAGTGGTGTTCTGTCGTCGAGGATGGCCTC
GACTTCATATTCACCGGCAACTTGGTCTGGTTCCCAGCTGTCCTCAGGCAGTAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCAAGTACC
AACCGAGTGTTCGGTCGACTGTTGAATTCGTTGACAGCCTTGAGTCTTGACACATGCACTACTGGGTAAAAGCGATACCCACTTCGATCAGGCAGTTCCA
GCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCATGTA
CAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGAGCTCTTGCAGGATCTTCCATCTCTTCCGAAGCTTCTGGAGGGTCCGCCGAGTGTTCG
TTTCCACTTGGTTGAGGTACAGCAGCTTTTTCCAGTCGACTCAGGGCCTCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGATAATCCTTGG
CCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTGC
CCGCAACGTCGACTGCGCATCCCAACCATGAACGAGGTAGAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACTAGCTTCTCC
GCGATTTCATCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGATCCCATCACCGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGTG
GCCGATAGCTCAAAGTCGCTCGTGATCTTGACTGCATCATATCTGCAAATGCTTGGCTCATGAAGCGTGGGTCGCGGTCGTGCCTTATTAATGATGGGGC
TCCGAATCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGTGAACGAGCAC
TGAAATAGGAGCAACGCCGTGTTGCCCCTACGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTAGCACGTTAC
CAGGTGAGTATCCACGAAGCTGTGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCGGCGTACAAGCCGATCCAATA
ATAATCGGACTTAACGCGGTGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTCTTGAATCATCGTTGTC
GGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTCTTCTGATAACACGAACC
GGTCAGCGTATTTCCAGGCATTTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTTGGCCCTGAAGCACCTTCTTGATACTAAACCACTTCTGCTCCTCGTC
TTGTGCCACCTGTATCCGTCTGCGTCGTTCCCGCTGTATCGCTACCGGGTCAACATCTTCCGCATCGGGAAATGCCGCTGGTACAGTCTTGTGAGGATGG
TCTGGCAAATCTTCGCCGAATGAATCTTCGGTGGACGTCTCTCGTCGTTCTTCATTCTGTTCTTGAGCTTTTGAGACATCCTCCGAGTGTTCATCTGCAA
ACCTGACGCGTTTCTTGGCTTTCGTCTGTCGCCGAGTCATCACTGCTATATTACCATAATCGCACTTTGGTAAGCTGTAATCAACCACGAAATTTTCGAA
AGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCTCGTGACGAAACATCTACCGAGTCTTCATCCGGCTCGTAGATC
ATTTCCTGGATGCGGTTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGATTACTCGACTGACCTTCGATTCCAGCGCTTCAGTGGCTAACGAAT
CCGCGGCCGCGTTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTTGGCCGTAAGTTCCTTGTGAGTATTCAGCAGCGCTAGCAAAGTTTC
CTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCAACGATGACTAAATCCTTGGCACCGTGCGCAATAGCAGCCTTGACA
CCGTTTATCATACCTGTATACTCTGCCTCATTCACCGTGGTAGCCGAGAGGTAAGCGTTTGCAGCAATCACTACCTTCCACTCAGGAAGGCTCCACAGCA
CCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCCGCTGTAATTACGGGAAAGCCTGGCGTACAG
CAACGCGGGGTCCATTCGAATAGCCGGGGAACCCTTGTTTGGAGGCGCCACCGGCGCGAGCGAGTCTTCCAGGTCAACGAAGCTCGTGATGCTTGACTGC
AGTAGCTGCGCAAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTAAGGTGCCACTGCGATATCAGCACTGCGAACTGGACCGCGCGTCCGAAGAGAG
ACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAA
CGCCAAAACTTCCTGCTCGGCAGGATGGTAGTTCATCTCGGCTTCCTTAAGCACCCGACCGAGGAACCGTACGGGGAGTAACTTGCCTTCATGTTCTTGC
ATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCG
TCTTCAATTTTTCGAAGGAACGACGTGCCACAGAAAGGCCACCTTCAACGGCAAAGTCCTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAA
GTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAGCTCGGTGATAGCTGCCAGCTTC
TTGGGGTCAGCCCTAATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAGAAGATGCTCTTGGTGAAGCTAATGCTGATCCGAC
ACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGACCGTCGACCAAA
TACAGGTACCAGCGATGATTCGTCTGGTTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTCTCTACCGGTGCT
TCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATCTTCTCCGAGTATT
CAAACCAACCTCCTTTAGGCTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGATAGATCATCGGCGCGTTCTTTAGCCCGAAGGGCATGCGTAA
CCACTCGAAATGTCCGAGTGCGCAGACGAACGCCGATACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCAGCGAGCAG
AACCATAGGTAGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCATATTCCATGATCGCGGTGATAGCATTCACCATCTTGTAATCAATGC
AGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGACGATCAGTCCTGCACGCAATAAAGCGCG
CAGCAGCTCGTACAGCTTGCCGAGAAATCGCAGCGGCACGCGTCCGGCACGCTGTTTAACTGGGGCGTGCCCCTGTGTGTCGATATCGCATACCGCGCCG
TAGACTGGCGGCGGCAGTGCGTTACTACTAGCAATCAGGATGTGCTCGTGGTTCTTTAGCGTCGCGACCAGACGTTCT