Description :
From Genome Similarity Track
Location :
contig_276:393- 2182
Transcript NameFunction/comments
g12267.t1hypothetical protein

Sequence
1789 bases(100 bases per row)
TGTTTTTTGTAATAAGAGAAGAAGAAGCTTTCCCTTGCAACACAAGTGGCGTTCGTTTATTCCAGGCTGGGAAGTATATTGGCCCTCCTGACGACTTCGG
ACTCACCTCGTCGCGCAAGGTAATACACGGGAGCCCCTGGATCGCTTGGCCAGGTGCGCAACCACTTAACCCCCCCAGAAGACCCCGCCATAGGAGGCGG
CAAGCACGTAAAGGAACACACCCAAGGACACCCCCCACGCCGATCAAGCCCCACCAGGCCCCGATCGGCAGACACCGACGACCGCGTGAAGAATACCCGC
GTGGCCGTCACCCCCCAGTTCCCCGGAAGGAGCCGTCCAGCTCCCCACCCCATCCTGGTAACCACCGACGCCTTCAGTGAACACCGGAAGAGCGTAACCC
GCCCCGCCGTCGGGTACACAAGGTGAATACAAGGTTCCGATCGCGCCAGATCAACGGAGTACCCCCTCCGATAGTCGGCAGTCCGGGCGTACCGCTGGTA
AGCCGGAGATCACGACAGCAATTTTCGTGATCCCGCTTCGCCACAATGGTGCGCGTGCCCGGATCTTCTGGTGATTCACAGGGATTTCACCGTGAGTCCA
CAGAAGAAGACGTCAAAATCAAGATGGAACCAGGGAACGAGTCGTCGACGGAAGAAGGATCGCCGCCGACGGCGCTGAAAGCGCCAGGATCCACTGATCG
TGAGAGTGCCGGGAGGAGCTCTGACGATGTGAAAGAGGAAGGTTCAGCGATGGACCTAGAAGAAAAGCCTCAAACCCCTCCCCAGGTCCCCTCGGGGACC
CCCGCGGATCGCGATGCGAATCGTGATCCGCCGGACGAAGGTCCGACGGTGAAAACCGAAGGACCTTCATCCAAAACCACTCCTCCAGTTCCGCACGCAA
CCTCGAAGAAGAAGAAGTCGAAGCCCTCACGCAAGAAGCTGAAGGCACCGGAGTCTGAAGCCGAAGACCAGGAGGATCGCAACACGTGGACGGACGAGCA
ACTGGAGTCTGCCTTCTTCTACAAGGACCTTTACAAGTTCCTGCACGAAGACCCTGTAATGAAGATCGTGCGCCCGAAGCCAATTGGGGAACTGCAAGGT
CCAGTGAAGGCACCGAAGGAAGTAACCAGCCAACTCGAGGCGGTGAAACTGCTGATGCGCATGCTGAAAGAAGCGGGAATCGTGCTCGGCTCCTTCGACG
CGAACGAGCTATTCGACTTGGAATTGCCAATCATCAGGGAATCAACGCTGAGCCTGTTCGCGAAGCTGACGCCCCTTGTCGGTAGTGTCGTCCCGGTTCA
ACGTGAAAGACCACACCGACTCGCAGCCAAACCGGATCGTCGCAATATGCCTCAGCCACATCCGAAGCGGGATCGGACAGCTCGATCGAGCTGCAGCGGA
TGACACTTGGGCCGGCCGGAGCAGCCATGCTACAGTCGCGAAAGGAGAGATCGGAAACCAAGCCGACAGTGATCGCGACGAGCGATCCAGCCCAAGCTCC
CCTGAACGCATGCAATCGTTCTTCAATGCAGCAATGGAGCGTTTCCTGAAGGAACAGCAAGCGGTCTCGACCACGCCAGTCGTCGACCAAACCAAGCCAC
CTGGAGCTCAAGACGTTGACATGGAGTCCGTGGAGTCGAATCGCCGGGACCATTCGCACCCGAGCGAATATCCGGATGACCTGGGTGTCGACGCTACCCC
TCGTGCCGCAGTCGCATCTGCTGGGACTACAGGCGGCGGAACACTCTCAGCCACAAGGATCCGAGTCTCCGCGATCTCAGAACTGAAGG