Description :
From Genome Similarity Track
Location :
Scaffold_1528:393- 1756
Transcript NameFunction/comments
Hyaar_Emoy2814759lysosomal alpha-mannosidase, putative

Sequence
1363 bases(100 bases per row)
GTATGCGCAGTATGCGCTCGAAGACGGAGTCGCAGTTTGTCCGTTCGCTGCCTGTATAGGGCGCACGCCCGTGATGCTGTAGGCGACCGAAGTGCGTGCT
TTCTGCGAACAATGCGAGCCATGGACGATGTCGACGCTGTGAAGATTTGGAGGATAGGATATCTATCCATGGGTTGTCTTGTCTAAAAATCATGACTTTG
TGGAGCGATACAAAAAGTAAAAGTCGGGGGAGGGGTGTTCAGTAAAGCAAACAGCGATGCCAACTTGAATCACGCGGAATCAGATCAAGAGATCCTTCGG
AAATGTGGGTACACACACACCCGTTTGATACCCACTCACCCACCCCCTCAGTCACTCACTCTGTCTTCGTCCACCACCAAAGATCCCGTCGCTTTTGACC
CGAAATGCGCGTGCGGGGACCTCTCACCGCATTGACGACGGCAGTCACAATCGCTGACGCCATAAGCAGCTGCGACCCCAGCAAGTGGATCCCTCCCCAC
CACGGCGTGTACAACACCACGAGCCGCGTGGACCCGACGAAGCTCAACGTCCACCTCATCGCGCACTCTCACGATGACCCGGGCTGGCTGCGCAACGTGG
ATCAGTACTACGTCGAGAAGGTGCAGTACATCTTGGACACGGCCGTCGAGGAGCTCGTGCGCGACCCGGAGCGCCAGTTCATGTTCGTCGAGCAGTCGTT
CTTCCAGCGCTGGTGGCACGAACAGGGCGCTCCCGTGCGTCGTGTCGTCAAGCGGCTCGTGAAGGAGGGACGGCTGGACCTCACGGTCAACGGAGGCTGG
TGCATGCACGACGAGGCCACGACGCACTACATTGCCATGGTGGACCAGACGGCGTACGGCCACCAGCTGCTCATGGACGAGTTCGGCATTAGTCCACGCA
TTGGGTGGCAGATCGATCCATTCGGCCACTCGGCTACGCAGGGCTCGCTGCTGTCGCAGGGCGTGGGCTTTGACGCGCTCTATTTCGCTCGCATTGACTA
TGAGGACTACGCCAAACGCAAGAAAGACAAGGAGCTCGAGTTCATTTGGCGGCCGAGCAAGTCGCGGGGCAAAGCGTCGCAGGTGTTTACGGGAGAGATC
ATTGATCACTACTGTCCACCTGGTAAATTCGATTTCGGCAACAATGCCAACCAGGTTCAGGACGATGCAGAGCTCCATGACTACGACGTTTGTGACGAAG
TTGAGCAGTTTGTCAATAACGTGAAGATGCGCGGCGACGCGTCCAAGGGCAACCACGTCTTTGTGCCTATGGGTTGTGACTTCCAGTACGACAACTCGCG
TCGCTGGTTTAAGAACATGGACAAAATCATTCACTACGTCAACCAGGATGGGCGGGTAAACGT