Description :
From Genome Similarity Track
Location :
Scaffold_548:393- 1610
Sequence
1217 bases(100 bases per row)
GACCCGCATGCCGGGTCGAGACGCCCTCGTGAAGTAGACGACTCGGACGCTTCGAACTCGAAGCGTTCGCGCGGCGAGAGCGACACTTCGCTCTCTGCTG
CTGGGGCTTTAAGCTCCCCGCGTGAGGTGGCGCCTTCAAGCTCTCCGCGCGCTGCTCAGGCAGCGCACGATCCGTGCATGCCGTCTGCGTCAGAGATCGC
AGACCGTGTGGGCAACACTGTGCCTCCTAACGAAATCCCGCTGTACGTATGCAGTGGTATCCACGACGATGCTGTTGCGGAGGAGCAGCACTTTGATCAG
TTAACGAATCAAAGGTGCGATTATTACATCGGGCTCTTCTACGAGCTCCGGTACTTCTCCAGCAAGAAGACTTCTTCTAGCAGCAAAGTGCCTGAGTGGC
AGGCACTTTGTCAAAGTTGGAATGCTTTTGTTGAGAACTTCAACAAGAAGCCGGTTGCTTACCGTGAGCGGGTTAAGCATGCCCGTGAGCGCTTCGAGAC
ATTCTCGACGCGCGGGAGGCTGGAGCAGCTCCCCAGATCCTCTGTGGACGCTGGTATTCCATGCGCTGTGCCTGAAGGCCATCAGTGCACGTTGTGTATT
CCGGGTGCGGCGCGCTTCAGCGACCGCGACCTAAACGGCTACACGACGATTCGTGTACCTGAGAGTCTCAAGGATCTTCGTGCCAAGTTCTTGGCACGCG
AGGAACGCGACGATCGTGGGACCTCGGGCGCTGTAGGTGACCACAGCGCTCGCACTACCTTCGCGTCGGCAGTGCATGGAGAACTTCGTACGCCCTCACC
ATTTCCGGGACGTCCTGCAGCAGGACGTCCCGTGGCTCCCATGTATTTTGGTGGGGCGGAAACCCTCTCCAACGAATACGATAACGAACCGGCTGCCGGT
TCGTTTTCGGGATACTATGGTTCAGAATACGCTCAACAATCGAGCGTGTTGAGCCGCGGGCGTCGCGGATCGGAGGCGGCGGTGGTGGGAACACGCCCCG
GGTATGGTCAACCTGGGGTTGACCTTGGCCGAACGCTCGAGGAGCGGGTCGCTGCTGTGGAACAGCTTCAGAGCCGGGAGTTTGCCGCTCTGAAGCAGGA
GGTGGCGATCTTGAGGGCTCAAGTTGCTTAGACCTCGCAGACCGCGTCGGACATCTCTGTCGACGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNC