Description :
From Genome Similarity Track
Location :
Scaffold_12:392995- 394523
Sequence
1528 bases(100 bases per row)
CGTACAGCAGACCTCCACATGACAAGTTTGATGATGGTTCCCAAGTTGTATCTTCATAGCCCACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGT
GCTCGTCGTTAGTGGTGTTCTGTCGTCGAGGATGGCCTCGACTTCATATTCACCGGCAACTTGGTCTGGTTCCCAGCTGTCCTCAGGCAGTAGTTCCTCA
TCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCAAGTACCAACCGAGTGTTCGGTCGACTGTTGAATTCGTTGACAGCCTTGAGTCTTGACACATGCACTA
CTGGGTAAAAGCGATACCCACTTCGATCAGGCAGTTCCAGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGC
TAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCATGTACAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGAGCTCTTGCAGGATCTTCC
ATCTCTTCCGAAGCTTCTGGAGGGTCCGCCGAGTGTTCGTTTCCACTTGGTTGAGGTACAGCAGCTTTTTCCAGTCGACTCAGGGCCTCATTATGCTTTT
TAGCCCTTCGCTCCTTTTCTACAGCCTGATAATCCTTGGCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCCAGTGCGTCAGA
CTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTGCCCGCAACGTCGACTGCGCATCCCAACCATGAACGAGGTAGAACGGCGTTTCCTTCCTCGTA
GTGTCTTGAGAAGTATTAATAGCAAATACTAGCTTCTCCGCGATTTCATCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGATCCCATCA
CCGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGTGGCCGATAGCTCAAAGTCGCTCGTGATCTTGACTGCATCATATCTGCAAATGCTTGGCTCAT
GAAGCGTGGGTCGCGGTCGTGCCTTATTAATGATGGGGCTCCGAATCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCT
GACATAGCCTTGGCAATAACGAATCCCGTGAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTACGAGATTTCGGTAGTGGGATCACAAAATCCA
TCGAGACGATCTGGAAAGGTCGTTCGGCTAGCACGTTACCAGGTGAGTATCCACGAAGCTGTGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTT
CACATGCTTCTCCACGTCGGCGTACAAGCCGATCCAATAATAATCGGACTTAACGCGGTGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAG
TCGTGACAGTTCTGCAAGACCTCTTGAATCATCGTTGTCGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCAATC
CAAGATAGTGAAGCACGCCGTCTTCTGA