Description :
From Genome Similarity Track
Location :
Scaffold_185:39293- 44955
Sequence
5662 bases(100 bases per row)
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAATTCCACCATTGGCAAAGGATTCGCTACAATTTGTAAACGAATGGACATATCCCCCGAAGGATTTCCTCAAGAACGTGTTTTGCACGTTCTGTCT
GACCATTTGTTTCAGGATGGTCAGAGGTCGACATCTGAAGGCGCGTTCTGAGTGTTTTGAACACGGATCGCCAGAATTCCGCAGTGGATCGTGGGTCTCG
ATCAGAGACGAGTTCACGAGGCAACCCATGAAGACGAAAGATCGTGTCAATAAAACACGAGCACATGCCGATGCATTGATATTTTCAGGTACAGCGACCA
GGTGTACCATTTTACTGAATCTATCAACGAATACAAGAATACCTGTATTTTTGTGTGGGTCTGCGGGGAATCCAAAGACAAAGTCCATTAAGACTGATTC
CCAGCATTCTGCCGGAATGGGTAAGGGTTGCAACGGCGCGCGAAGTGAAGGACCTGACTTCACTCGTTGACATACTTCGCATGCGCGGACGTACTTTCGC
ACGAGCTGATACTGGCGGGGTCAGTAAAAGTCGCGACTAACTGTGAGATATGTCTTCTCTCGACCACGATGTCCACCAGTAGGTGCATCGTGGTACTCAT
ACATGATGCGCAGTCGCATGTCACCATGGTCCGGTACGACGACACGAGGCGTGTCGCCGGCAATGTAGTAAACCATTGTGGACTATATATCTATCCGTGG
AGGATCGATTTACTGGGGGCAACCTTTTAAGGGATTGACAGGATGGTTGCGAGAGATGATCCATCAAACGCACCATCGCCAGATCGTACGCCTTGCGTAT
GGCTTCGAGTATGGTTGACGACGGGCCGCTCGACGTCAACACCGCGACAGTGGTCGGACCAGTTTCGGGTTGCACAGCCGGTTCTAAATCGGGTCGGCGC
GACAGATCATCAGCAACGACATTCAGTCGTCCTGATTTATATTCCACGAAGAAGTTATACTCCGCGAAGAACGACATCCACCTCGCCATTAGTTGCGAGA
GGTGTGGACTGTTAACGGCCGTGCGTGCTCCGTGTATACGATGAAGGGTCTATCATCTAGTAGGTAGAACCTGAATTTTGCTAAAGCATACTTCATGGCA
AGGAGTTCCTTGTCATCGACTGGGTAGTTACGTTCAGCTGGTTGCAGCTGACGTGACTGATAGCAGAAGACACGCTCAGCATCGTCTGTGTCGTACTACA
TTAATGCACATCCGATGGCAAAATCACTTGCATCGCAGACCACATGGTCTGTCTTGGTCTGCAATCGCCAAAACTGGAGAGCGTATCAAGCTTTGCTTGA
TACCTTCAAATGAGCGCTGACAATCAGCACTCCATGCCCACTTCTCGTTCTTTTTCAATAAACGAGAGAGATGAACAGTCATCTCGGCGTAATTGTGCGA
GTATTTGTGCAAATACGCCGCTAGGCCAAGGAACTTTCGAAGTCCTTTTATGTCGGTAGGCACCGGCCAGTCAGTGATCGCCTTGATCTTTTCCGGATCG
GGCCGGACGCCGTGCTTACACACGATGCATCCAAGAAGTGGTATTTCGCTTGCAGAAAATATACACTTCTTGAGATTGGCATACAACTTATGCTCACGCA
TCAGTATAAGAACTTTCTAGACGTGGAGTCGGTGGATTTCCAAATCCGTCTGCCCATCCATAGCCTGGCTATGGACGAACACGTCATCGAAATAGCTGGG
TGCGAATTCTCGCACAGATCTCAACAGATTCGTTACACATCTGTTGAACGTAGCAGGGGCATTACTAACCACTCCCAAAGCATACCGATTGGGGTGCTCA
CTGCTGTATAAGGAATGTCCTTTTCACGCATAAGGATCTGATAAAACCAGTCCATCAGATCCATCGATGAAAAGATGTTACTCCTTGACATTACATCTAT
AATGACATACTTTCTTGGTACCGGCGTTTGAGACGGTACAGTGGCAGCATTCAACTTGTTGAAGGCATGTACTATCCGCCATCCTCCTGTGGCCTTTCGG
ACACAGAAGGTCGGAGAGCTATGTGGGGAAGTGATTCTCATCCATGTCCCGCTGCCAAGCGATCGGCAAAGAATTTGTCAATCGCTAGTACTTGTTCACG
AGGCAGTGGACACTGCTTCATGACAGTACTTTGAACCTGGTTTCAGGTCGATTTCGTGACGAGTACCCTTATCCTTGGGTAGCTCGCACGGCACTGTTTC
TGGGAACACATCTCTGAATTCCGTCAAATCATCGTAGAGAGGATTTGTCTTGAGCGATTCACACGATTGGGATGTATATCGCTTAATCCGAGTCTTCTCA
TCAACGACACTCTCGTCCATTGATGAGCTGCTGAGAACCCTTTCGTTCTCAGCGAATACCATTGCCGACAGAATATCGGTTACGTACTCGTCTTCCACGA
CGAGTACGCAAATCTGCTTGACTTTTCCACTACGCAGATCACGCAAGAACCTATTCAGTTCGAGCGTGGGCAATTGAGTGATCTCCGAAGTTGTCTTCGG
AGGTGCGATCAGATCAAGTTGGTAAGTGCCTATTCTTGATCCGTCATCGAACAGGACATTTAATGTCTCTGTTATCTCCTGGGAACCACAGTTGGGTGGG
GGCGTATTCCCTCACTAGCCTCTTGGGCTAAATCATCACATGACACGAGTGGAATTGCTCCCTCGTTATCTTCTGGCGGTGGTTGCGCTACCGCGGCCAG
GTCTTCTACGTGCGATTCTCCAATCGCACTAAGATCATCATCATGCCAATCATTGGCAATCGGTTCGTTGTCACTTGGGTGTCGACCGTTAGGAGGACAC
CCATGCCCCAGTCCATTCGACTTATTCGGGTGGTGGGCCTTCGGCACGACCTGCATCTCAATGCAGTCGCGGGAATCTGGCTTCATGGTGTGGCGATCAG
CCACTCCATGGCCATGTGCAGTTGTGCTAACGACCGAACCACACGCGAGGCCATCGCACTCGCTCGTAGTACACCCACATGTTTGTGGGCGATCCATGGC
GTTCATCAGATGGCCATCTGATGAACAAGTGACAGGCTATCGACTGTTCGTAGATGCCAGCTGACTTGTGGCTCGTACCTTCTGAGCCACGGCAGTCCAA
GGTGACATCAAATTTGTCATTCAAGTCTAGTATGATGGAGTCATCATTGTATTGGACTCCCTTCAGTGTATAGGTAATACCCACTACACGTTTCATCACT
GTTACGGATGCGCCTGTCGCGAGACGCACGTCATCCTCGTTGGAGGGATCTCTCGCTCAACATATTCGAGCTCTCTTTTGTCTAGCGATTGGCGTCGTAC
AAAGTTGTTCGACGCCCCACAATCGACTAGGGCTCGAAGCGACATGCCTTGTGTCACTTCGAGTTTCAAGGTAATGAGGGAAACCTCATTACTAGAAGCA
ACAACACATAATGACTGAGTGTTGAGAGCAACTTTCGTCAAGAGGCCTACAAACACACTTGACGTTGCTGGATCAGTAGGGTGCTCCGCACCTAATGAAC
CTGACCGTTTTATTGGCTGTCCGTTACGTTGTTGCGTTTTCGCAACAACGTCGGACCCACGCCTTGGACCTCTCTTGGCCGCTTGGTGGTTACTGTTTTC
CTGCGGTACGTGGTACCGCCCTCGGGGCACTGCATTCATATGCATGATGCCCTGTCTTCTGACATCTATTGCATTTTTGCAATTTCTTATAGTTGTTAAC
ACGAGAGCTCTCGCGCCTCGTGTTACAGAGGTTCATGGGTTCTGGGCCTCCATTTTCCTGTCGTCTCGACGGACGATAGGAATTCGAATTCGCGTAAGCC
TGTTTCACGCTGAGTCCTCCTGTTCCGCAACCCTTATTGTTCTAGGGTATTGAACTCCAATCGGAACATCGGAACAGGTAGGTTTTAACTGGACCATCAG
TCAGACCCTGCATGCACAATGTAATCAACTTTTGTTGGTTCAGTGGGTCGACTGTTATGCAACTGGTACGGTGACGTATGTACTGAATGTACGAGTGTGC
GTCACGTTTACCTTGCTTGATTCTCAGGAGTTCAGAGCGAGCCCTGAACTCCGCTCGTGGCGGCTCAAAAGTTTGCCTTAGTAGGGACTTGAAGACTTTC
AACGACCCAAAGACATATGGGTCGTGTAACTTAAGGCCCAAGACCCACGTCTTTGCACGCCCTGCCAAGTTCGATTGAGCAAATGCGATCTGCATTTCCT
CATCGACGATATGACGAGCCCTTATGGCATCGTCTAGTTCCACGAACCATCTCAACAGAGAGTCTTCATCGGCTCCCTTGTACTTTGAGATGTCAATCTT
TAGAGTCTCAGGTAGACGTATACAGGTCGACCCGGTAGCAGTGGCCTGCTGCTGTCTCAACAGCTCAAACTGTTGAGCACTATGTTCTCTCAACAGCTCT
GTCTGTTGAGAACCTTGTGGTGAAGCAAGGTTACTTTTGAATGAACTTGGAGATGGTGGCGTGCTGTCCGTCTGTCCCCAGGGCGGAGAGCAGTGCGCTA
CGGCTTCTTGTCCTATCGTTGAACTCGAGCGTTCAACAGCGTCCCATTCGATTTGACTCAAATGGGAGTATATTTCATGCGCGGGATGAAAATCATCCCC
CTCATCGTCCAACATGTTCATGGTCGTTGAACGGACTACGAAGTGCTACCAGGTGTAACGGG