Description :
From Genome Similarity Track
Location :
contig_122:3929- 6355
Transcript NameFunction/comments
g13975.t1hypothetical protein

Sequence
2426 bases(100 bases per row)
GTTACCTGAAGAGTGCCCGTCACTCTTCCGAGTTGGTACATGGTGTACCCAACACCACTGACACGTGGTGGTGGCTCACAGCCACCCATACATAAAACAT
ATAGGATAAACTATAGTTGACTTAGGAATTGTATTGCAAGACGATCTCTAGGTAACTAACTATAAATATATCAGTCTATAAACTACGTTGTCTAAGTCAA
CCGTTCCCCAAGACCGGGAACTAGTGAACCGTCGTTCACTTGGAGTTTGTATACTCCTAGCACTTCCTCGAGCGCAAGGTGCTGTGTGACTCCCGTCACA
CTTGGTAGCACTTGTAGTCAATCCTCGCCTACGCGGGTAGGATTGGACTACCTGAATCCTCTGTGGTCTCAAGCATTGAGCCACCATGGATCGCAGTGAG
TTTCCTCACTTGAACGACTCGCAGTTCGAGTCCGTTCGGAAGATGGCGGGCATCTTCGGGATGGATGCCCTCCAGAGCTTGGCGGCAGCAACACCTGCCG
AGCAGCTCGAGCGCGTAAGCGCTTTCGACACGTACGAGCAAGGGCTAATCGCCCATGTACGTGGGAGCCTACAGGCCCCTATGGCTGAACAGAAATCAGT
TCAGCCCAAGCCTTTGAGGCTGAAGGTTAACCCCTACGAAGGAAAAGGAAGGGGAAAACCTTCACTTCTGGGTCCAAGAGGTCGAGCTCGCTATGGACGT
GGCTCTCGTCTCGGACGAGCGACTCCGCGTCGCTTTTGCTCTCTCCCACCTTAGTGGTCGAGCAAAGAGCTGGGCGTACACGCGCGAAGCGACAACGCCT
GGATGATTTGCATCCTGGGCTCAGCTGTGTGAGAAGCTTCGAGCCGCCTTCCTCCCGGCGAACTATGAGTACCGCCAGCGCTCACGCTTCCTTGCGTGCA
AGCAAGGGAGGCGTGAGCTGCACGAGTACATCCAGGAGATGCTGGAGCTTACCGCATCTCTGGTGGGAAACCCACTCCATGAACACATCAAGGTGACGGT
GTTCATGGACGGCCTGCGAGTAGGCCCAGCGCGCACGCAGCTGTTTCGGGTGCAAGCAAGCACCCTGGAATAGGCGATTCAAATCGCTCTTCAGGAGGAG
TACAGCCATCGACAGGCTCGCACTCCTGCCACTGCGTGGCTTGGGGGCTCCACTCAGGGCGGGCCCCAAAGTAGAGGCCCCTTCAACGGTCCTGTGCCGA
TGGACCTGAGCCTTGCCGAACAGCACGACATTCGCTGTTTCGGCTGTGGCAAACTGGGGCACATGAAACGTGCGTGCCCCGCGGGAGGAACAACACGGCG
GTTTCCTCCCAAGCCCTTTGGTCCTAGGGGTCGCTGGCAAAAGCCGCGACCCCGTGGCCAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCTACTG
GGGAAGATCTAAGTCTTCATGAGTGGTGCGCGGGTGGTGCGCACCATGAAGGCTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGG
AGGGCTGCTTGTAGTACATGCAAGTGTACGGGGATACGATCATCCCATGAGAATCTTGATCGATTCTGGGGCGTCAAAGAACTTTGCACGCCGCCGGACG
GTCGCTCGCAAGAGCGACCAGTTCACCGATGCTTTACGAGAAAGCAAAGGGAACGGGCATGTCCTAGTCAGACTGGCTGACGGGACTGTAGTGGAGGTGC
CCAAGGTCTTTATGGACCTGTCCGTCAAGTTTGAGGACTTTAATTCCACTGAACCGATTCCTCGTTCTTGATATGGACAAGTACGACTTGATCCTGGGCA
TGCCATGGCTTGAGAAGCATGAGCCCTGGATAGACTGGCGCGGCAAAGCCATCGGGGCTAGCCGGCCTGCTGCTACTGACAGAGCATTGGTGAGTCATGT
TCCCACCTCTGTCAGCAGCCGGGCCTACCACCGGAGCCGAGTCGGAAACGACTCCGAAGAATTAGTTGCGGCAGGAGCCGCAACAGGTGTCATGACACCG
TCCACGCGGGCAACGGACCGCCACAGGCAATGCCGGTGGACGGGACGTCGAGTCCAGCGAGGGGAACTGCAATGCCAGCAGTACCCACCGCTCCTGACTA
TGGCACCGTACGGCCTTCGGCCTTGTCGACGCCAGGGGAAGTCAACTCCCCAAGGGAAACGAGCCCACGTGAGACCAAGGAGGTCGAGACCGTGGCCAGG
GTCGAGGTTGCTGGGAGCACCTCTGGTGTGGGTAACAATGTGCCACACGGAGTCGATGGAACTCCCGACTCCACCCTTGAGTCACCACCGGCTGTGGGTA
ACAAAGGACCACGCCGTGGTGGGCATCGACGACGTCGTCGCCGCCGTAAGCCGAGTCTGTGAGACAGACTGGAGTCGCTACAAGCGACTCGGAGAGAGAG
AACTCTCCTCAGGCACGGCCGGCCGA