Description :
From Genome Similarity Track
Location :
contig_122:3929- 6350
Transcript NameFunction/comments
g13459.t1hypothetical protein
g13460.t1hypothetical protein

Sequence
2421 bases(100 bases per row)
GTTACCTGAAGAGTGCCCGTCACTCTTCCGAGTTGGTACATGGTGTACCCAACACCACTGACACGTGGTGGTGGCTCACAGCCACCCATACATAAAACAT
ATAGGATAAACTATAGTTGACTTAGGAATTGTATTGCAAGACGATCTCTAGGTAACTAACTATAAATATATCAGTCTATAAACTACGTTGTCTAAGTCAA
CCGTTCCCCAAGACCGGGAACTAGTGAACCGCCGTTCACTTGGAGTTTGTATACTCCTAGCACTTCCTCGAGCGCAAGGTGCTGTGTGACTCCCGTCACA
CTTGGTAGCACTTGTAGTCAATCCTCGCCTACGCGGGTAGGATTGGACTACCTGAATCCTCTGTGGTCTCAAGCATTGAGCCACCATGGATCGCAGTGAG
TTTCCTCACTTGAACGACTCGCAGTTCGAGTCCGTTCGGAAGATGGCGGGCATCTTCGGGATGGATGCCCTCCAGAGCTTGGCGGCAGCAACACCTGCCG
AGCAGCTCGAGCGCGTAAGCGCTTTCGACACGTACGAGCAAGGGCTAATCGCCCATGTACGTGGGAGCCTACAGGCCCCTGTGGCTGAACGGAAACCAGT
TCAGCCCAAGCCTTTGAGGCTGAAGGTTAACCCCTACGAAGGAAAGGAAGGGGAAAACCTTCACTTCTGGGTCCGAGAGGTCGAGCTCGCTATGGACGCG
GCTCTCGTCTCGGACGAGCGACTCCGCGTCGCTTTTGCTCTCTCCTTAGTGGTCGAGCAAAGAGCTGGGCGTACACGCGCGAAGCGACAACGCCTGGATG
CTTTGCATCCTGGGCTCAGCTGTGTGAGCAGCCTCGAGCCGCCTTCCTCCCGGCGAACTATGAGTACCGCCAGCGCTCACGCTTCCTTGCGTGCAAGCAA
GGGAGGCGTGAGCTGCACGAGTACATCCAGGAGATGCGGGAGCTTACCGCATCTCTGGTGGGAAACCCACTCCATGAACACATCAAGGTGACGGTGTTCA
TGGACGGCCTGCGAGTAGGCCCAGCGCGCACGCAGCTGTTTCGGGTGCAAGCAAGCACCCTGGAATAGGCGATTCAAATCGCTCTTCAGGAGGAGTACAG
CCATCGACAGGCTCGCACTCCTGCCACTGCGTGGCTTGGGGGCTCCACTCAGGGCGGGCCCCAAAGTAGAGGCCCCTTCAACGGTCCTGTGCCGATGGAC
CTGAGCCTTGCCGAACAGCACGACAGCCGCTGTTTCGGCTGTGGCAAACTGGGGCACATGAAACGTGCGTGCCCCGCGGGAGGAACAACACGGCGGTTTC
CTCCCAAGCCCTTTGGTCCTAGGGGTCGCTGGCAAAAGCCGCGACCCCGTGGCCAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAA
GATCTAAGTCTTCATGAGTGGTGCGCGGGTGGTGCGCACCATGAAGGCTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGAGGGC
TGCTTGTAGTACATGCAAGTGTACGGGGATACGATCATCCCATGAGAATCTTGATCGATTCTGGGGCGTCAAAGAACTTTGCACGCCGCCGGACGGTCGC
TCGCAAGAGCGACCAGTTCACCGATGCTTTACGAGAAAGCAAAGGGAACGGGCATGTCCTAGTCAGACTGGCTGACGGGACTGTAGTGGAGGTGCCCAAG
GTCTTTATGGACCTGTCCGTCAAGTTTGAGGACTTTAATTCCACTGAACCGATTCCTCGTTCTTGATATGGACAAGTACGACTTGATCCTGGGCATGCCA
TGGCTTGAGAAGCATGAGCCCTGGATAGACTGGCGCGGCAAAGCCATCGGGGCTAGCCGGCCTGCTGCTACTGACAGAGCATTGGTGAGTCATGTTCCCA
CCTCTGTCAGCAGCCGGGCCTACCACCGGAGCCGAGTCGGAAATGACTCCGAAGAATTAGTTGCGGCAGGAGCCGCAACAGGTGTCATGACACCGTCCAC
GCGGGCAACGGACCGCCACAGGCAATGCCGGTGGACAGGACGTCGAGTCCAGCGAGGGGAACTGCAATGCCAACAGTACCCACCGCTCCTGACTATGGCA
CCGTACGGCCTTCGGCCTTGTCGACGCCAGGTGAAGTCAACTCCCCAAGGGAAACGAGCCCACGTGAGACCAAGGCGGTCGAGACCGTGGCCAGGGTCGA
GGTTGCTGGGAGCACCTCTGGTGTGGGTAACAATGTGCCACACGGAGTCGATGGAACTCCCGACTCCACCCTTGAGTCACCACCGGCTGTGGGTAACAAA
GGACCATGCCGTGGTGGGCATCGACGACGTCGTCGCCGCCGTAAGCCGAGTCTGTGAGACAGACTGGAGTCGCTACAAGCGACTCGGAGAGAGAGAACTC
TCCTCAGGCACGGCCGGCCGA