Description :
From Genome Similarity Track
Location :
Scaffold_99:39284- 42200
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19085hypothetical protein

Sequence
2916 bases(100 bases per row)
CTCTGCCCGCTGTTAATGCTCTGATAGAGCTGGACGAGATGTCTATCGCCGAGTTTGGCGAGGCCTTGAAGGCAGGCGGCTTAGCTGAAATTATTTTGAT
AAGGCCTAAGGAGTAGTTGAACCACTCCTCCGCTTTGGTTGCCGCGGTCCTGGAGGAAACCAAGAAGGCGCTAAGCACGAGGAGTGGATCGGCGATTCAT
AAAGATCGTTCGGATCCCTTCTACGAGGTGGTAAAAGAGTATGGAGACGTGGTCTTGAAAAACCCGCCGATGTTTTTGCCTCCAGATAGAAGCGTACGTC
ATAAGATTCACCTGGTTCCGCGAACCAAATAATGCGCTACACGGCAGGGGTCCTTGCCAAAAGAGCAATATGACGCCATTAACACGTTCTTCCGCGCGAA
GCATGAGGCAGGGTTGAGAGCAAGTCTCCGCCGGCTTTCTGTGTCATAATGCCGAATGGCGCATTGTGCATGCTTTTAATAAACTATACGCGACCAACAT
TCCGGCACAAACGCCGATTTCTAGAAAGGAAGTTCTACAGAAAAACATGGCGGCTGTACGTTGTACAGTGCACTCGACTTGGTCGACGGTCACTACCAAT
TGTTTATGAGAGCGAGCGACATTCTGTTGACAGCGGTGAGCACTCCGAGCGGTATGCTCTGTGAGGGGTTGGTGATGCCCCAGGGCTGTCGTACGCACCA
GCAACAATCAACGTCTTGTGACGCAGCTGCTCAGGTTCCATCGGGCGTACGCGCAGACGTATTTTCACGATATCTTCGTCCATATTCGTGCTGAGCACGG
AAGGTCAGATGTGTAGAACCACATAGTTCACTGACGAGCGGTGCTCAAGTTCATGTGCACTAATAAGTTGTATGCCAATTTGGACANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCTACAGGCTTTACTCCTTTCAACGTGAACGG
CCTTGTGAATCCCCACGCCCCGCTAGAACTGCCACGTGGTGGCTCAGGGCTTGAAGGGTACGGAATAGCCGAGAGGCTTGCTGATGCCAGCCCTATTCCG
GTACCCAAGCAAGTTGATGACTTCGTCTCGCTGGGACTTAGCGTTATGCGCCAGGTGCGCGACGCTATAGCTGAGAGCCAAGACCTACAAAAGGTGCATG
CGGTTGCTCGGAGCAGAGAGAATAGAAAGGTTTGAGGTCGGAGACCTCGTTTTATTCAATGCAAAAAAAAACTACCTACACACGCAATGTCGCCGTCTTC
AAGACAAAACTAAGACCTAGGTTCATTGAACCGTTCAAGGTCGTGGCCAGGAAGGGCCTATCGTACACGCTTAATCTTCCGAAGAAGATGCGCACCCACC
CAGTGTTTTATGTGGG