Description :
From Genome Similarity Track
Location :
contig_5:3927- 9012
Transcript NameFunction/comments
g1602.t1POM81867.1 Transposase [Phytophthora palmivora var. palmivora
g1603.t1hypothetical protein

Sequence
5085 bases(100 bases per row)
CTCAACAGGACTAAGCGAACACGGGCATGGTGGCCACGGCACTCCGAGCTGCGTGCACGGCGGCAACATATCAGGAAAGTCGGCCACGGGACGCTGAACT
TGGTGCCGGGCGGCAACAGCGTGTGCTGGACTTTGCGCACACGTTTACGGCGTCCACAGTGCGGGCGCGACGCGAAAGGACTTGGTGCACGACAGCTGCA
GCTTGGGATGGACTGGGCGGCCGCAGTCTCAGCACGAATGGACTTGGTGAAGGAGGGAACGACGGACACAACGCGGCTGGCGGCGCCTGTCAAGGCCGTG
GTGATGCCCAGAACGGCGCAGTTGGCCTACCACAGGAACGTCGCGGGCACTGGGCTGCAGTTGGAGCTGACCCTGGCGATGATGGCCAAACAGATCCCGC
GGCGATGGCCGTGGGTGCAACGCTGCCACTGTGTTATTTGGGACGAGAAACACTTGTTGATAATGCTAAAGACATTGACCATAGTTTATTCGATATATAT
TCGGTCATGTTGCTCTGAAGGCATTAACATACTTTAATCAAGATAAATACCCTCTTCTTTGCCTACAGAATGCGAATCATTGGAATATCTGTCGCGCAAC
TCTGCTGTCTTGACTCGCTGAATCTTCGCTGAGCAACTCTGCACAATCACTACTGAGAAGTAGGTCGGCTTCGTCGACGGAGAGTACAGAACTGTCGCTC
TGGGTCTCATAAGAGAGCACGACACTATCGCTGTCGGGGATAGGGAGAGCTTTATCGACGGGTCTCGCGGCGCTACTTGCCTTCAACTTAGCCAGATGCG
ATGACCTGTTGACATTTCCATTGTCACTGAAGAGGCCATTAGGGAGATAGAATCTGTGAAACTTATCCCAACAAGTCCAAGTGCTCTGTGGGCACGTGTA
CGGACTCTCGATGTATCCATGCACAGTGCTACAAAGACAAACAGTGTGCGTGAGGCAATAATCCGTCACCTCTGTAGGATATCTGCCCTCGTAGCGACAC
ACAATGCACTGCCGACGTTTCCGCCCACTGTCCTTGAACATTTGTTTCGAAGACATAGACTGACATCGCTTCAGGGCGCTGTGCGGGTTTGGCGAAGTGT
ACACTTTAGGAGTTATACCAGTTGCATCCACTGCTGCGGTTTCATCAGCAACACCGCTTCCAAACGCCATTTGACCATCGCTCGGGGCTTCTTGCCACCT
GCCAGAAATTAGCTCAGATACTAATTCAGTGACAAACGTCCTGTGGGGATCTCGATCTCTGGAAGTGTCGATTGCCATCCGTCGAGTCAGGTACGCGTTG
GACCGTGCAATATCCACTATTGCCAAAGCCAATTTTTTATGCCATTTTTTGAACGAATGACCATCAGCTAGTGAAAATCTAGCTCGTATCTGATCCAAAC
GATCAACACCTTGCATGTGTCGATTGTATTGCAGGATACAGCTCGGAGCAGGAAACTCATGAGTATTTTTACCAACCCGCCGCGTGACTGTCGCGGCAGT
AGATGCATCAGCATTGGTAACCATCATCACGGTATTGCCATCGCACCACGACGCAGCGAGCAAGTTGTGCTCCAGGGAGACAGACTGCTGATAGTCACCC
CTTGTTGAGTGCTCCTTCTGGAGAATAGTGTGCTTCGGATAGTGCTTACTCCTTCCCCGAACAGTTCCCCGCCCATACAACCCCTTCAAACGCAAATCCA
ACAGCAACTGGACGCTTGTGTAATAGTTGTCCATATTGATGATTCGTCGAGAGTAAAAGTAGGGCCTCACGACCTCTAGAACATGCTTACGCACTTGTTT
GACATCCTCGAGCTCCTCACGAAGCTGCTGCACCTCTTCTAGGCTCACCACGTTTTGCAGGCGGTCCGCGATATCACTATTATTGCAGTGGAGGCGATAG
TTCAAAGCGATCCACGTGGTCGAGCAGCACAGCACGTACATACGAAAATGATACTTGCCGCCAGGTTTTGGGGATTGAACACGATAAGATGTCGTCCATG
GCGGGACCGGCATGCGATACTCGCTTCGTCAAGAGCCAAGTCACGGCCAGGCTCAACATAGCGACCACCAGTGCATTTGAGCAAATTCAATAGGGGCCTA
ATTCGGGCTGCTGGGTCTCGTTCCACAGCCGATCCCGGATCAGCGCGAAAGCTCAAACAGCGGCGAAGCAACTTGAATCTATTTAGACTCATCACATTGT
CCAAGCTGGTAGATGCACCACCAAAAATCGCATCTTCAGTCTGTGGCCCCCAGTAGTTAGAGTACTCCCCCTTGTCAGTGAGGGTCAGATAAAGCATGAT
GCCGAGGAAGATCATCAGCTCTTCCATTGTAAACGGCGTGGTGATTCGAACATTCTTGAGGGCTGCATATCGATTCGTCTCGAGAACCACTTGTTTCCAA
AAGTAAATTGGAATGTAAGCGAAGAAGCTCGAAGAGGCTGAGTGTGCAAACAGGTGACTGTACTCGGGTAGTAAGCGTGTACTAGTGCTCTCGTCCGTGT
GTTCATACAGATCCGTGGGGCCATCTATTTCCACATCTGGCTGAAACCGCATACTTTTCACCGCTTCCACCTCCGCAAGGCTCACGGGCAAAAATCGCTC
TGGATCGTACATTTCCATACCGTCGTCGCCTGACGCGACTTCAAGTTCATCGAGCGGTTCCTCCATCTGCAGCTCCCCTTCCACCACTGTATCAGTCAAT
TCACGCCACGCCGGCTTGTTGGGTGAGCGCGCGAGAGCCTGGTAGTTCTCGATCCCACGCTGAATTACTGCCACAGTCAGAGTTTCAACTGCATTCTGGA
ACTGCGTATCTAGCCAAATCACTTGTAGTATCCCTCCCTTCTTCGTCGTTTTGACCTGACGACACACACGACCGACAATAAAGGCTCTGTCCACGCATCT
ATACACCTTTTCCTTCATCCACAATTCCTTTGACGGTGAAAATGCCACCAGCTTCTTTAGTAATAGATACTCCATCAAAGGGGCAGGAGGAGTACGTCTC
TGCGGCGTACTGCGCGTGGGGACACTCGTTGGGGTTTCTAGGTTGGGATCAATCACCAAGCTCGCTTGCCGTCTTGGAGTCTCCGCCCCGGTAGCTGCGG
TAGCCGCCTCTTCCATCACGCTCCTGACACTTCGATCTCCGCGACCGCTTCCGCGTCCGCGGCCAAGACCACTACCGCGCCGACGCCCACACCCACGAAC
TCGAACACTACCGCGGGCACTACCGACGGTCCCGCTGCCACAACGCCGCCACCATCGTCGCAAGGCCCTTGCGCGTCAACAACTGCTTGCTGCCATCCGG
TTGATGCCGCGACAACACCATCGTTGCCAGGCTCACGCGCGTGAATAATGGCTTGCTGCCATGCGGCAGACACCATTGTCACCAGGTCCACGATCACCGC
CATCGTCGCCGGTCCCACCGCATCCGCCGTCACCATCGCCAAGTCCACGCGCGCCACCGACTGCTTGCTGCCGTCCCGCCGTGGCCGTCGCCGCGCCGCC
ATCCCCGCCACTTGAAGCACTGTGTTGAATGAAGTACCGAAGTACAGCCTCCTCGCCTAGCAGGAAGTCCTCGCCATCCTTTCCATTGGCAGAGCGACCA
GGTAGCACGTACCGATACCGGTTGTCAAGACCGCGTGGCAGTTTATGCGTCCATCCAGCAGCCTTCAGCTCCTTCCACACGCCGTTGAAGTCGAGCACCC
TCGTTAAACGTGCCGTGTCATTGTCCTGGGACGCTGCATCACACCGCGGTCGCCGCCGCTTTGGCTCGGCTGGCATCTCTTCTCCGCGCGCGTGCTTTCG
CGCCATTTCGTACAGGGAGAAAAAAATCAGGAAATGAGCGGTTTGCACAGCCGTCAGAGTGGTCGGTATAGTTTAATAAAGACAAATGCTCCACATAATT
GCTCCCGGCAGGTGCACGTCTATGCAAGGATACCATATGCGATGGGAAATTTACGTTGGGGGCCGTGGTTTTTGTGGTGTTTCATTGGATCGTTTGGACC
AATCACTGAAGAGGAGTCGAATCTGCCCAATCAGGTACATGCCGACGCAGTACCGTGTCTTCGTAAAAGGAGGCAAAATGCCTCCTTTTACAAGGGCCCT
ACCGCAAAATGTAACTACAGGTGTCGTGTTGTCTGACTGCGTACTTAGCTGGAGAGCCCATCACCACCTCAAAAGGAGGCATTTTGCCTCCTTCTACAAA
CCAGTATCTTAACTTTGTATAGTATAGTTAAGGTAGGTGGCTCACGAAAGGGTTAACCCCCCTACGCCCACACGTTGTATTTGACAACATGAATCATGTT
GTACGTACAACATGTTTGAATAGGGGTTGGCTCGGAAAACGGCTAAGTATAGTGAACTCAAATTTAATCAAATCCTGACAAAGCCGAGACTTTCCCGCAA
ATGCACAGGGGTAGGCATAAACCGCTCATAAACGAAACTGGCATCGGTAGATGGCTGGTGTTCATTTGAAGAAAAATAAAAAGAACGCAAGAAAGCAGGA
GACGCATGGCGAGGAATAAGGCCCGGCGAGAATCCCGAGCTCAGCACCAGCGCGTTCTGGAACGTCTGGGTGGTCGTAACCCAGAGGAGCGGCAGCATCT
TGTGAAGGAACATGCTGCCTATTTGGCCGGAGAGCGCGACACCGACGTTGACTTCAGGGACGACAACCAGGCGCCATCAGCGGCTGAAGAGCCGCGCACT
GCCCCCCGCAAGACCTGGAAACCTCCGGCAAGACCTCCGACGGGTAAGGACGTTTCTTACCTTAGGGCCCAGAAGCGTCTAGTCTCCGAGCAGCGCCGAG
CTGTTGCCGCGAAGACGTCCGCTGGCTCTGGAAAGAAACTGGCTGTCACGAGAACTACCAAGGACGACGACAGCGAGTTTAATCCCGACGAAGTAGATGA
TGATGACGACGAGGAAGTGGAGGAGATGGATGTCGACAGTGTTGAGAAGGAGACGGAATCGAGGGCGGCGAAAAGGAAGGCAAAGCCTGTGGCATCGACG
ACAGCGAAGAAGAAGGCAAAAAGCAGCACCAACCCTCGAGGGAAAAGTGGTAAAGGTATGTCATGTTTGATGTTGTATGATACAG