Description :
From Genome Similarity Track
Location :
contig_27:39256- 40285
Sequence
1029 bases(100 bases per row)
GCGATTGACCCCCAAAAAAATTACTCCGGATATATATATATATATATATATTCTGTCTGGTATAGAATATGGGTTTGAAAGGGGTAATACTGACAGGGAA
AATATAACTTTGAATATCTTACGAAAAGTGGCAGGATTTCCTTAAAATAATATTTTAAGGAAATTCTAAAAATATTATTATTGTTTAGGGGGGATTGCTT
TAAAAAAATTAAGCTCGAAATTCAAGTTTTATTTTAATTCGTATTAAAATACTGTAGCTTTAATAATAATTCAACGACAATGTGGCAGGTGGACGAGCTG
CATGTGAAGCAGCAGCTCCGAGAGCAGCAGCGGGCGTGGTACGTTTCCCTTCTTCTCTCCAGCGCTATGCATCCATCCTCACTGCGCCCATTAGGGAAGC
AGAAGAGATCGCTGCCGGTTGCTCCGATCCCCCGTCGCTTCAGTTTTGGAGTATTGGGAAGTTGCTGCGCGTGCTTCGAGAGTCTAAATCCGCTGCAAAT
CCGCTAGAAACTCTGGCTGAGCGAGGAATTACGCGGTACTCGGTTGGCAGTTGTGACCAGCGCCGATGGGCGTCGCAGTCCACAGCAGTAGAGACGCAGC
ACTTCCCTACTGCGGACGCTGTGACCTACACGTCCAGTCACATTTGGCTCACGGGATTTCTGCATTTCGGAGAGGAATTGGACACTTGCGATACATTTTT
TTTATGTGATAGCAACTCCAAACTGCCGAGTTTCCTACTGGACCCCAATCCCCAGTTGACGACGGATCAGTTGGTGCTCGTGAAGCGCTGGGTGCTGGTA
GATAAGACGATCGGCGGGGTTAGAACCGCGTGTTCAATGTTTCTAGAGGTCCACGATGCAAAACCCATGGCGCTGTTACCGGTGACCTATCCGTACGCAG
ATTGGACGCAGGAGGACGTGATTGCGGTGCTTGAAGCTAATTACCAGACGAAAGACCCGCCGATGTATTCCGGCACGGAGCCATGGGGTGCAGTTGCAGC
GCTATCGAGAAGAAGTGAGGCTGATAACG