Description :
From Genome Similarity Track
Location :
Scaffold_1:3925508- 3926690
Sequence
1182 bases(100 bases per row)
GTTCTTGAGCGCGACATCGCGCCAATCTTGGCCTTCGTGAGCTGCACGGAGAACCCGGTGAACGGTGGCGTCGTCGTACAGCATTGCTGTGTGGGTAGGA
AGCACAGTGAGAATTGCTAAATGAATGAAAGGCAGTGCGGCCACAAACTGCAGCAACAGTGTCCACTGATTCCATCGACGCCGTACAGCCAGCCAGCGTC
CACCAAAATTGGCGGGAGTAGTGGCCGCCACTTTTTGCCTCTTTCATCTAATGAACTCCAAACGTAAATACTCCCATAAATATTAAGTGTCAGTGTCATG
TCATTTTGAACTTTACGTTTTGTCACTTTGATTTTACCTGTCGCCAATTTTGAAGTTTGAAAAAGGTGTAGAGCCTTCACCGGTGGAAAATGCTCTAAAA
TGACTTTATTTTATAGCTTCCTGGAGCTGCTGAAGTTTATGGGTTTGTGAAAGTGTGGAAGGAAAGAGCAAGGACTGCGTCCAGCTCAAACCCTGAGGCT
CAGGTGCTTCCAGGACGCGATGCTCGCGTCCAGAAGCCGGACTTCGACGGACCATTGGCTGGCGAGCCGCCAGCCCCATCCTACTGCTAATCCTACCAAT
ATATGTTACCGGGGTTTTTCCGTGTGCTGCTACACACTCGACAACTTGCGCCGTCAAGAGCAAGCAGCAGCACTCGGTTTTCTCCCCTGCTGGACTTTCA
GTCCCTGCAACTTACTGTTGTTACGACTACTTCCTTCATCACAATGGTCACCACTCGGCGTAGCCGAGGAGCGACCATCACTCAGGTTATGAGCCCAAGA
AGGAGAGCTGGAAGCCCAGTCCGGAGTACGCAGAGCTCGCGCGCGTCCGACGAGTTGCAGTTGCCTGCAAGAGCAGACGAGACAACGTCAGACGAGACAC
ATGCGACGTCACAAGCGTCATCAACCCGAGTTGAGCAACAACTCGAGCTCTTATTGGCCCAATTCGGTACCGTTATGACTACACTGACCAATCAGCAGCA
AGTGCAGAACATTCCAGTGGAAGCATCTACCCGACGCCCACAAAGGCAGATCATTCAAGAATTCTCAGCGGCTCGAGCACAACCGCAGCGAGTGCCGACG
CCGTACGGGCCCCGCCGAGGAAACCCAAGCACAGAGGAACTTACCGCCGACGCCAGCACGCGTCAGAGCGAGCCGCCAAGAA