Description :
From Genome Similarity Track
Location :
contig_5:3925- 9010
Transcript NameFunction/comments
g1295.t1hypothetical protein PHYSODRAFT_323413

Sequence
5085 bases(100 bases per row)
CTCAACAGGACTAAGCGAACACGGGCATGGTGGCCACGGCACTCCGAGCTGCGTGCACGGCGGCAACATATCAGGAACGTCGGCCACGGGACGCTGAACT
TGGTGCCGGGCGGCAACAGCGTGTGCTGGACTTTGCGCACATGTTTACGGCGTCCACAGCGCGGGCGCGACGCGAAAGGACTTGGCGCACGACAGCTGCA
GCTTGGGATGGACTGGGCGGCCGCAGTCTCAGCGCGAATGGACTTGGTGAAGGAGGGAACGACGGACACAACGCGGCTGGCGGCGGCTGTCAAGGCCGTG
GTGATGCCCAGAACGGCGCAGTTGGCCTACCACAGGAACGTCGCGGGCACTGGGCTGCAGTTGGAGCTGACGCTGGCGATGATGGCCGAACAGATCCCGC
GGCGATGGCCGTGGGTGCAACGCTGCCACTGTGTTATTTGGGACGAGAAACACTTGTTGATAATGCTAAAGACATTGACCATAGTTTATTCGATATATAT
TCGGTCATGTTGCTCTGAAGGCATTAGCATACTTTAATCAAGATAAATACCCTCTTCTTTGCCTACAGAATGCGAATCATTGGAATATCTGTCGCGCAAC
TCTGCTGTCTTGACTCGCTGAATCTTCGCTGAGCAACTCTGCACAATCACTACTGAGAAGTAGGTCGGTTTCGTCGACGGAGAGTACAGAACTGTCGCTC
TGGGTCTCATAAGAGAGCACGACACTATCGCTTTCGGGGATAGGGAGAGCTTTATCGACGGGTCTCGCGGCGCTACTTGCCTTCAACTTAGCCAGATGCG
ATGACCTGTTGACATTTCCATTGTCACTGAAGAGGCCATTTGGGAGATAGAATCTGTGAAACTTATCCCAACAAGTCCAAGTGCTCTGTGGGCACGTGTA
CGGACTCTCGATGTATCCATGCACAGTGCTACAAAGACAAACAGTGTGCGTGAGGCAATAATCCGTCACCTCTGTAGGATATCTGCCCTCGTAGCGACAC
ACAATGCACTGCCGACGTTTCCGCCCACTGTCCTTGAACATTTGTTTCGAAGACATAGACTGACATCGCTTCAGGGCGCTGTGCGGGTTTGGCGAAGTGT
ACACTTTAGGAGTTATACCAGTTGCATCCACTGCTGCGGTTTCATCAGCAACACCGCTTCCAAACGCCATTTGACCATCGCTCGGGGCTTCTTGCCACCT
GCCAGAAATTAGCTCAGATACTAATTCAGTGACAAACGTCCTGTGGGGATCTCGATCTCTGGAAGTGTCGATTGCCATCCGTCGAGTCAGGTACGCGTTG
GACCGTGCAATATCCACTATTGCCAAAGCCAATTTTTTATGCCATTTTTTGAACGAATGACCATCAGCTAGTGAAAATCTAGCTCGTATCTGATCCAAAC
GATCAACACCTTGCATGTGTCGATTGTATTGCAGGATACAGCTCGGAGCAGGAAACTCATGAGTATTTTTACCAACCCGCCGCGTGACTGTCGCGGCAGT
AGATGCATCAGCATTGGTAACCATCATCACGGTATTGCCATCGCACCACGACGCAGCGAGCAAGTTGTGCTCCAGGGAGACAGACTGCTGATAGTCACCC
CTTGTTGAGTGCTCCTTCTGGAGAATAGTGTGCTTCGGATAGTGCTTACTCCTTCCCCGAACAGTTCCCCGCCCATACAACCCCTTCAAACGCAAATCCA
ACAGCAACTGGACGCTTGTGTAATAGTTGTCCATATTGATGATTCGTCGAGAGTAAAAGTAGGGCCTCACGACCTCTAGAACATGCTTACGCACTTGTTT
GACATCCTCGAGCTCCTCACGAAGCTGCTGCACCTCTTCTAGGCTCACCACGTTTTGCAGGCGGTCCGCGATATCACTATTATTGCAGTGGAGGCGATAG
TTCAAAGCGATCCACGTGGTCGAGCAGCACAGCACGTACATACGAAAATGATACTTGCCGCCAGGTTTTGGGGATTGAACACGATAAGATGTCGTCCATG
GCGGGACCGGCATGCGATACTCGCTTCGTCAAGAGCCAAGTCACGGCCAGGCTCAACATAGCGACCACCAGTGCATTTGAGCAAATTCAATAGGGGCCTA
ATTCGGGCTGCTGGGTCTCGTTCCACAGCCGATCCCGGATCAGCGCGAAAGCTCAAACAGCGGCGAAGCAACTTGAATCTATTTAGACTCATCACATTGT
CCAAGCTGGTAGATGCACCACCAAAAATCGCATCTTCAGTCTGTGGCCCCCAGTAGTTAGAGTACTCCCCCTTGTCAGTGAGGGTCAGATAAAGCATGAT
GCCGAGGAAGATCATCAGCTCTTCCATTGTAAACGGCGTGGTGATTCGAACATTCTTGAGGGCTGCATATCGATTCGTCTCGAGAACCACTTGTTTCCAG
AAGTAAATTGGAATGTAAGCGAAGAAGCTCGAAGAGGCTGAGTGTGCAAACAGGTGACTGTACTCGGGTAGTAAGCGTGTACTAGTGCTCTCGTCCGTGT
GTTCATACAGATCCGTGGGGCCATCCATATCCACATCTGGCTGAAACCGCATACTTTCACCGCTTCCACCTCCGCAAGGCTCACGGGCAAAAATCGCTCT
GGATCGTACATTTCCATACCGTCGTCGTCTGACGCGACTTCAAGTTCATCGAGCGGTTCCTCCATCTGCAGCTCCCCTTCCACCACTGTATCAGTCAATT
CACGCCACGCCGGCTTGTTGGGTGAGCGCGCGAGAGCCTGGTAGTTCTCGATCCCGCGCTGAATTACTGCCACACTCAGAGTTTCAACTGCATTCTGGAA
CTGCGTATCTAGCCAAATCACTTGTAGTACCCCTCCCTTCTTCGTCTTTTTGACCTGACGACACACACGGCCGACAATAAAGGCTGTGCCCACGCATCTA
TACACCTTTTCCTTCATCCACAATTCCTTTGACGGTGAAAATGCCACCAGCTTCTTTAGGAATAGATGCTCCATCAAAGGGGCAGGAGGAGTACGTCTCT
GCGGCGTACTGCGCGTGGGGACACTCGTTGGGGTTTCTAGGTTGGGTTCAATCACCAAGCTCGCTTGCCGTCTTGGAGTCTCCGCCCCGGTAGCTGCGGT
AGCCGCCTCTTCCATCACGCTCCTGACAATTCGATCTCCGCGACCGCTTCCGCGTCCGCGGCCAAGACCACTACCGCGCCGACGCCCACACCCACGAACT
CGAACACTACCGCGGGCACTACCGACAGGTCCCGCTGCCACAACGCCGCCACCATCGTCGCAAAGCCCTTGCGCGTCAACAACTGCTTGCTGCCATCCGG
TTGATGCCGCGACAACACCATCGTTGCCAGGCTCACGCGCGTGAATAATGGCTTGCTGCCATGCGGCAGACACCATTGTCACCAGGTCCACGATCACCGC
CATCGTCGCCGGTCCCACCGCATCCGCCGTCACCATCGCCAAGTCCACGCGCGCCACCGACTGCTTGCTGCCGTCCCGCCGTGGCCGTCGCCGCGCCGCC
ATCCCCGCCACTTGAAGCACTGTGTTGAATGAAGTACCGAAGTACAGCCTCCTCGCCTAGCAGGAAGTCCTCGCCATCCTTTCCATTGGCAGAGCGACCA
GGTAGCACGTACCGATACCGGTTGTCAAGACCGCGTGGCAGTTTATGCGTCCATCCAGCAGCCTTCAGCTCCTTCCACACGCCGTTGAAGTCGAGCACCC
TCGTTAAACGTGCCGTGTCATTGTCCTGGGACGCTGCATCACACCGCGGTCGCCGCCGCTTTGGCTCGGCTGGCATCTCTTCTCCGCGCGCGTGCTTTCG
CGCCATTTCGTACAGGGAGAAAAAAATCAGGAAATGAGCGGTTTGCACAGCCGTCAGAGTGGTCGGTATAGTTTAATAAAGACAAATGCTCCACATAATT
GCTCCCGGCAGGTGCACGTCTATGCAAGGATACCATATGCGATGGGAAATTTACGTTGGGGGCCGTGGTTTTTGTGGTGTTTCATTGGATCGTTTGGACC
AATCACTGAAGAGGAGTCGAATCTGCCCAATCAGGTACATGCCGACGCAGTACCGTGTCTTCGTAAAAGGAGGCAAAATGCCTCCTTTTACAAGGGCCCT
ACCGCAAAATGTAACTACAGGTGTCGTGTTGTCTGACTGCGTACTTAGCTGGAGAGCCCATCACCACCTCAAAAGGAGGCATTTTGCCTCCTTCTACAAA
CCAGTATCTTAACTTTGTATAGTATAGTTAAGGTAGGTGGCTCACGAAAGGGTTAACCCCCTACGCCCACACGTTGTATTTGACAACATGAATCATGTTG
TACGTACAACATGTTTGAATAGGGGTTGGCTCGGAAAACGGCTAAGTATAGTGAACTCAAATTTAATCAAATGCTGACAAAGCCGAGACTTTCCCGCAAA
TGCACAGGGTAGGCATAAACCGCTCATAAACGAAACTGGCATCGGTAGATGGCTGGTGTTCATTTGAAGAAAAATAAAAAGAACGCAAGAAAGCAGGAGA
CGCATGGCGAGGAATAAGGCCCGGCGAGAATCCCGAGCTCAGCACCAGCGCGTTCTGGAACGTCTGGGTGGTCGTACCCAGAGGAGCGGCAGCATCTTGT
GAAGGAACATGCTGCCTATTTGGCCGGAGAGCGCGACACCGACGTTGACTTCAGGGACGACAACCAGGCGCCATCAGCGGCTGAAGAGCCGCGCACTGCC
CCCCGCAAGACCTGGAAACCTCCGGCAAGACCTCCGACGGGTAAGGACGTTTCTTACCTTAGGGCCCAGAAGCGTCTAGTCTCCGAGCAGCGCCGAGCTG
TTGCCGCGAAGACGTCCGCTGGCTCTGGAAAGAAACTGGCTGTCACGAGAACTACCAAGGACGACGACAGCGAGTTTAATCCCGACGAAGTAGATGATGA
TGACGACGAGGAAGTGGAGGAGATGGATGTCGACAGTGTTGAGAAGGAGACGGAATCGAGGGCGGCGAAAAGGAAGGCAAAGCCTGTGGCATCGACGACA
GCGAAGAAGAAGGCAAAAAGCAGCACCAACCCTCGAGGGAAAAGTGGTAAAGGTATGTCATGTTTGATGTTGTATGATACAGCAA