Description :
From Genome Similarity Track
Location :
scaffold_1144:3925- 6637
Sequence
2712 bases(100 bases per row)
AAGCCTGCGCCGTTCTCGCAGGCTCCTCTTCAGTCACTTCCGACTCCGTCGGAGTGTTGGCAGTCCATGTCCTTGGACTTTGTCTTCGGTCTTCCGCCTG
ACAGCAAGCGGAGGACGGGCATCGTTGTCTTTGTGGACCGATTCAGCAAGACGGTCCATCTTGCTGCCGTCCCGGCTACTGTTACAGCCGCGCAGACTGC
GTGACTGTTTGTTGTCATGGTGTTCAAACACCATGGCATGCCGCTCGACATTGTGTCGGACCGTGATCCACGCTTCACAGCGCGGCTCAGGCAGGAAGTG
TTTACACTTCTTGGTTCACAGTTGTCAATGTCGACTGAGGATCATCCGCAGACGGACGGACAGACCGAACGCATCAACCGTGTGCTGGGTGACGCGCTGA
AGAGCTACGCTCACTCGTTCCAGCATTGGAGCGAGTGCTTGCCGATGGCAGAGTTTGCCATCAACAACTCGGTGCATGCCTCGACTGGACATACACCGTT
CTACGTGAACGCCACGAGGCATCCACGTTTGCCGAGCATGGTCGGCGGGGTAGCTTCCTCCTTAAATGGGGGAGGATCTACGGTTGCGTCTGAACAACCG
CAGAATACAGCTGATAGCACACTATCAGCTGCGGTGACGCGTGCAGCGTCTCGTTCGAGTAGGAACAGACGCTCGATGTCTGTGCTGGGCACAGACATAG
GGAGTGATAGCGCGCAGGCAGGGCCTGCTGCGGACGAAGACGACGAGCTGAAAGGATTCAGCTCGAGCGCGCTAGACTTTGTCCAGCGAAGACAAGCCGC
GATACGGTTTGTGGAAGACGCTATCGCAGCTTCTGTCGATCGACAGAAGCTGAACGCTGATAATGTTGGCAGGGGCAACATGAATGAATTCAAAAAGGGT
TCATTGGTTTTGTTAGCTACTCAAAACCTGCCTAAACATGCAGTGTCTGGCTTTGGAGCAAGTAAGCTTGCTCCAAGATTCATTGGGCCGTTCACAGTAC
TTGAACGGCACGGCAACGCGTACCGGCTGGACATACCGTCCAGCATGAGGCTCCATCCGACGTTCTACGTCGAGCGGTTGAAGCCGTACGTGCAGCACCA
GTCATCTAGGGTTAATGACTCGCCTGGGAGGCCTGGAAGGCCTCCTCGAGCTCGCGGAGACGCTCGACATACCAGTTCAGCCTCGACCCGAGACTGGACG
AGAGGTTTGAGGCAGTCTGAGCCGCCTCAGCGGCGTCAGCACGAACGTTCCTCACCTCTTGACGCAGAGACGCTATCTCAGCGCTCCGGGAGTGCTCAAG
AGCAGCAACCCGATCGTGATGGTCATAGCGTTGACCATACGCAGGGAGTGTTCCCACCCCCTCCGCCGCCGTTGCGCGACGCGAGAGGAGCGATCCGCTG
GATAGTTGAGTGGATCGTGGATTATACGATGACGACCCATCAAATTCATCGTTTTCGAGTTCGCTGGAGAGGATTTCCTCCCCATCGAGATTCATGGGAA
CCACGGAACGCCCTAATGGAGGACGTTCCGGAAATGGTGAGGGCGTACGAAGTCCGCCATAACTTGCAGGGTTAAGCCCTGCACGAGGAGTGCTGCGGTC
AGCCACAACACTCAAAGCCTTGCGTGGCTCAATACGAGTACGGAGCTCCTTGATGTGATCGGGTACACGCACCGACGTGTACCCAGTAAGGTCACTTTCG
GAGAGGCGTGCTGCCATCTGTAGGCAGCACGGGTAGCTCGTGCTAACAGGTACGGCGCAGGGAATTCCCGCTTCCATGCATAGACCATGGAGGCGTTCAC
ACCTACTGCGAACGGTGTAAGTGTAGTAGCGTTCGCGAGCATTGTCAACGCGCTCGCGATAGGCTTTCGGAGCCTTGTTGAAGTTTTCAACAAAGGCGTT
CCACGACTGACAAACCCGGTTTTTTTGCCGTCCAGAAGTCAGTGACCATCGTCATACTCTTCACACCACGGAGCCGGTTGTCAAAGATATAGCGAACTAG
AGCGAGTTTTGCCGACACATAGAGCTCGATGACGGAGTGGGTAATTGTCCGCCGGTTGATCACGGTCTGGAAATTCTCTTTCGTGACAACAGCACGCAAA
ACTTGAGATTCTTCCCACTCGCCCATGATAAACGGTAAATTGTTGTGCACCACAAGTAAAGTTTGAAGTAGCAAGCTGATGCGTTCACAGCTTTCTTGGG
TTTGTGCAGAGGCTCTAATACGTGCCACCACCTCATCTCGGCTCCGTTTGCGGAAATCTTCCAGTGTTGACTTGGTTGAAGTGACGTGATGCGAGTCCTT
TAAATGTTTTGTTGCCCTGGATGTCTTTCCGCCGTACAAAACGTGCACGCTCTCGTTTGAACGACAGTGCTCACTTGCCAAGCACACTCACCCACATACA
GTGGGGTCACTTTGATGGCGAATACGAACCCCCCCCCCATTTGTAAATGAATGATCGTTCGGTAGGTCTTTGAACAATTAGCTCGAATCCAGCTTTTGGG
TGGTAATTTTGGACTGCAAATTCAACTTCAGCTGGAATTCCAGTCGGGTCAGGGTTGCTACGTACGGCAGCGTAGCCATCACAGATTCCGCTCCGCCGGA
GCTGCGTCTGTGCGCATTTACCCGCGCACCATGCGGCTCTCTTTTACTTGAGACTGAATTATTCGAAACTTCACTCGGTGGCGTTGCGCGTTCTTCTTGA
TAGGTTGGTATA