Description :
From Genome Similarity Track
Location :
Scaffold_621:3925- 5821
Transcript NameFunction/comments
Phymu_g11198hypothetical protein PHYSODRAFT_301465

Sequence
1896 bases(100 bases per row)
TGTTGTAGCGCAGGTCCAACACTCGAACGCCCGTGAGCATCCCGACGTCTGTCACCTTGCAGCAGTCCGACAAGTTGAGTTCATGAACGTTTTTCAGAGC
GGACACGTCCTCAAGTTGCACACAGCCAGAGAGATTGAGCGTGTGAACTCTGCACAACGCGGACACATCTCGTACATTTAAACAATGACGCAGTGACAGT
GAGTGAACCGCCCCCAGAGCCGAAACATCTTGGATATTCGGGCAGTAGCTAAGATCCAACTCCCGAGCGTGTGCGAGAGGCGAAATATCCACCAACTTGG
AGCAGCCAGCGAGTTTCACGACACGAGCGCTCCGACTCAATGGTGTTACGTCCTCCAACGCGTCACAGAAGCGCAGATCGACCTCCTGAGCGCCAGTGAG
GCAGTTGACGTTGTTGATAAGAGAACACCCGGATAAATTCACCTTGGTTAGATATTCGGCAGATTTTTTCAGCGCTGCAATATCCTCGAGTTTCTCGCAG
CGGTACGTTGTGATCGTGTGTACTCCACGCACGGAAGATCCCAAAGACGTCAAGTTCTTGCAGAAACTCACGTCCAGGTCTCGGACACGCGTAAGGCCGT
CGAGCGTTATCAATTGGCTACATCGTGAGAGCACAAGGCGATCGAGAGGAGGCAAATGGAGCAGTTCGGAGCTCGTGAAGCCCGTACAACTCGAAATATC
CAGTTCACgaaggctggagctggttcCCAATGCTGTTAAATCCGTCACTGCATCGCATTGCCTCAACGACAGCTCGACGACGCCCGCACTTAGTGCGGAG
ATGTCGCTGATGTATCTGCAgagcgcgagctggagcttgggCACTCGCCCTAGAGCGCTGACGTCCGTGACGTTGATGCATCCAGTCAGATCCAAGTCTT
GAACGCCTCCTAGGGCCGAGACGTCGACGATTCCTGCGCATTTACGCAGTTTCAAAGTGCGTACTTTACCCAGAGCACTGACGTCGGAAACGTTGATACA
GCCAGAGAGGTTTAACTCGACCACGTTGGCCAGTGCGCTGACATTCGTGACGTTCGCACAACCTCCGAGATTTAATTCGTGGACGTTGGATAATGCTCTC
ACGTCGCTCACCTCTGGACAATTCCGCAGACTCAGACGACGCACATGACTCAGTGGACTCACGTCGCTAATTCCGCGGCAAACGTTGAGTTGCACGCTCG
TACATTTCGCTAGTGGCGCGAGATCTGTGACGGCGTGACAGTACGACAAGTCGACGTGCTGTGAAGCACTGAGGAACGAAATATCCGCCAGGAAGTTGCA
GTAGCTTAAATCGACCTCGCGGATGCCTTTAAGCCAGTGCAATCCGTCGATTTGACTGCATCCGCTCAGTCCGAGCTCTTGCAAGCGGTTGACGCCGTCG
AACAAGTTGACCCGCACGATACCGGACAGGTTTAACCGCTTCACTTGAGCGTCGGTACTTTGGATAAAATCCCGCAGGATTTTTGGGCAGATATACCGCA
TCGGGACACTCACTCCCTCTTCGTCCGTGTACGTGTAGCTCCCTTGCGTTGGTTCTGGTTCAGGAGCTGGTTGGTTCTGCTCCAGGTCAAGGACCAATCC
ACCGGCAGCATTCACGTTGTAGTGGATATCTTCATGGACTCTCCCGGTCTCGTGGTCGTCTCCAACAGGTTGAAACGCCACGTTTCGGAGGTTCCGCCAC
TTGCTCAACACGCGCGATAACTCGAGAACGGGGCAAACCAGCGAAGCCTCCGAccggagctggacgtggtcGTGCACGATGCGGTAGAAGAACGGACTCA
ATTCGGCCAGTGCCACCGCCTCGTTCAGTGTCAAGAACGGAATTAAATGGCCGTCCCAGAGCTCAATAGGCATCGTGGCCTGCAAGTGGCAGATAT