Description :
From Genome Similarity Track
Location :
contig_166:3924- 9702
Transcript NameFunction/comments
g13995.t1hypothetical protein

Sequence
5778 bases(100 bases per row)
TCTGTTGGGATCGGAGTATGTGTGGCATTTGAAAGCTGCCGGCTTCCGGAAGGTGCGAAGTCCACGAGGGGTTGCGGATGAGGAAGCTGCGTCTAAACGT
ATTCAACGTGTGGCTGCCCGACCGCCTCCTTCCTCGATCCCATCACCGTCATCGCTCCCGTCGGTGCCATCTTCGGTTGTCCAGAACCTGGAAGTGTTGT
CCTCTAGAGGCAGTCTATCCTCCGCCCAGAATGTATCCGAACGAATCGGGTCGGATTCTACGCTGAGTATGTTTGGAACTTCCGGAGGATCAAGCGAGTC
GATGGCCAGTGCTACATCCAGTTCACGGACTTCCAGAGATAGTTCGTCCGGATCTTCCGGATGGAGTGTTTGCCAAGGTGCAGGAGTGCATATGCCGTTC
TCAGCGTTTGAACCACGGGCAATGACAGCTCAGAGTCTGGGAGGAGCCGTCCCGGCGGAGACTGGTGTAGGCATGTACGTCACTCACGAAGTGATTCCAC
GGAACCCAGTACCAGTGATTCAGGAAGACATCGTCATGTCAGAAGACGAAGCAAAGGGTTCTCGAAGACAGAAGCCCAAGGTTTCTTCCCGAAGGATCTC
CCGATACCGGTCGTACAGCCGCTCGTTCATACCGCAGTAGTGCTTCCGGAAATGCTGCTGAGACGACACATCAGAAGCCGGATGTGAGAGGCTCTGATGA
GATCGTCGCGGCACAATTGCAAGCTACTTTGCAGGCATTTGCTGCTGACAGAGTTTCGAAGAACCTGATGGGAAAAACCGTGAAGATTTCTGAGCCTATT
GTGAACGTGAAAGCGGAACCCGTTTCTGAAAGTAGAACTTTTGCAATGGGAAAGGCCGAGTTGTCCTCTGGAACCAAGTCAACTGCACCTGGAAAGTCTG
TCAAACGGCACATGTCCGAAAAATCTGGTTCGTCCAAGAAAAGTTCGACTTCCGGAAAGGGGAAGAGGACGAAGTAGTCATCTGGAAAGTCAAGTGATCC
TTCGGATTCGGATCCAAGTTCTGAGTGACTCGTACTCGGACAGTTCAAATAGCAGCTCTTTCGAGGATGTCGTTCCGAATGTCCATACGACATCGGGTCC
AGGCGGATCTCTGTTTACGTTCAGGCCGTACGTGAATGCCAGCACGTTGGAAGACTTCAATGAGAAGACGTCACTAGCTACCCGTATCCGGTGGTTGGAA
CGATTCCAGAGTTTTGCCGTTCAGGGTGGTTGGTCGGATAAGGTCAAGATCTATGAGATGAAGCTGAAGTTACCTGCTGCCGTTCGAAACTGGCGTTCGA
ACTTGAATCCCAACGTGCGCCGGAAATGGAAGAAGTTCCTGAAGGAGTTCCGTGATATGTATTGCAAGGCCAAGACCTCGGATTCAGAACGTTATTACAC
GATGATCCAAAAGAAGGCAGAAACTCCGCTGGAATTTTACTACCGCCTGAACAAGGTGGCCGACAAAGCTGGGATCGAGTTCGACGCATCGAGTAAGCAA
CGTGAGCGCCATCTGAAAGTGTTCACGAAGAAACGTCTGGACTCTCACCTCCGAACGACTTTACAAGGACAACGTCTGCGTCGTCTGAAGGATTTGGAAT
ATGTCCTGAAGCAGCATGAAGAAATGAATCAAGACGACGATTACGATACTCCACCTCCGAAGAGAGACTTCCGAGCGGACAATGTCCCTCGTGATCGATT
CAGACCGAAACGTTCTGGAAGAGCCTACGTCCTTCATGATGACGATAACCGGGATGGCGAGCACGACAGACAAGTCCATTTTTTGGAAGAAGTGGAAGAA
GTGACAAGTCGAGATCATGCTCCTAGTGTGCTGACTACTCCAGCTGCGGATGTCACGAACGTGTCCGGTTCGAGCATGGATAACCTTTCCGAAGCAGTAT
TTCGTGCGATGGAGAATCCCAGACGACGGCCCCCGACTTCTGATTTCCGTTCGGATCGCCGGCGGCAATATTTTGGAAGTCCGAACGCGTCCAAGTTCTG
TGACAAGTGCAAGGAGTTTGGACATCTGACGGAGAACTGTTGGTCGGACATCGAATGGGACATCCGACGCACTTCTGCAGGACTCGTCCGTGTGCGATCT
GTAACCAGTTTAACGAAGGCAAATGTGGAGAGTGGAAGGCTTTCCAAGCGATCAAGAATCTTGCACGTCAAGGAGCACTGAAAGATCTGCCGTCTCCTAT
CCGGAAGCAACTTCTGGAAGGGAAGGTGGATCCAGGGGAACAGCCGTTAAACTAGTAAGCCCGCTGGATGGGGATCCAGAACGCGACGGGCTGAAGAAAC
CGCCCGATATGTGTCTTCTAGTGTATGTTGGTCCGGAGTTGAGACGCCAAAACCAAGATAAACATCAATGCATGACCGTGACTCCGGAAAGTGGTGACCC
TCTTTCAGATGAACTTCGTCCTGAACGAGTTCTATCGGAAGGTGTACGGCCGGAATACAAGATCCGGATGTACCTGTTGAATTCCGATTGGGGCCAGGCG
AACGATATGGCTGGTGGGAAGATCACTGTTCGGATGACACGAAACGGATTGCGATGGTTCACGGAGCGGTGAACAATTGTCGGACAGACATCCTTTTGGA
TTCTGGAGCGTCAGTAAGCATGGTGAGTTTGGATCTTGCGCGTAGACTCAAACTCAAGTTAAGCTTCTGCAAACAGCTCCGGGTATCTGGACGGTGGCGT
TCCGACCATCATCACCGCGAGTGCTGAAGTGAAAATCACTTTGGGTCCGAGAATTGTGTATGTCTTGGAACTTGGGTCGCGAACATTGGTGAAGGTGTCG
ACGTGTTGCTTGGAATGAATTTCATGTATTCCGCTGGAGTGCGACTGTGCGCACGAGAAGGATTGGTGCAACTTCCGGATGAAGAAACTGTGTTGCTATC
AGGACGTGGTGCGGATCATTACCACAGAGGTTTGGACCTTCCGGTGAGACCGCGTGAAGAGCTTTTCCTGCGTCCAGGTGAACATGCTATCGTCCGGATA
CATTACGGACAGAGCAATCCACAACGTGATGTGGTATGGGCTGGTCGGGGAGACCGATGGGTAACCCAGATCATCTATGCTGCTAGATCGTGGGCTGTGG
CCATCAAAGTGGTGAATTTCCGGAAGGTGTCTTAGCATTGACACTCGGACGCCGGTTGCTCGGATCATCGAGTTTGGCTTCTTCCCGAGGGCAGGACGTT
TTGTCCGCCCGGGTCTCCGAAGGTATCAGGAGTGGCAGACTCTCATCTATGAGAATACCGAATCCAATCAGATGCGTTTACGTTCTGAACGATTTGAGCA
GATGATGAGGGACGCCGAACCTTGCGTCCAGAAGTCCGAATACTCACGGCTAAGCTATTGGTTCGACCGCTTCCTGGAAGCGACCAAGTTCACATGGTGC
AACTTCAGGAGCTGCCTCGTGTCTTACGTCCGAAAGTGGAGGAGACTCTTCCAGATGAAGTCATCGCAGAAGACACGGTAAAGCTGAAAAAGGACCCTGA
GGTTGAGGAAGTGCCACGTCCGGAAGATACTGGCGACGGATGTCATCCAAGGGAGTCGGAGTCATACCAAGGGTTGAAGAACGTTTGGAAGCGCAGAACT
TCTGACGGACGACGTGGATTCGGACGGAGATGAATTCTTTGATTCGATTAGTCTGAATGAAGAGTTTCCGGATGAAGGTGCTGACGATGTGGATGATTGT
CTGGGTGACTTGTCAGGATTGGACGAACTCCGGGATCAGCAAACCCAAGCCATGCTCTCTACCCCAATCCAAACGTTGGAAGTCGAGTATGAGAGGTGCA
TGCGTCTGAACGCAGAAGAGCTGGATTTGGAACCCGCTGTGTACATCCATGAAGGAAGTGACTTGTTAGCCCAATTGCGTGATCAGCTGGCGATGCTTCC
GGAACTCCAAGAGTTGAGCCCGACATGTGATATTGATGCGGCTGATGTGGGAGATTCGGAAACGACATCACCTCTGGAAGAGCAGAAGCTTCGGTCCATC
CTGAAGTACCACCGCTCTATTTTTCTGGGTGATGGAAATGCCGCTCCTGCTCCGGCAAGAGGAGTGATTTGTGATTTGGACGTTGGGACGGCCAAGCCGG
TCGCACAACGCGCCCGATCCATCGCACCTCATTTGGTTATCAAGGTCTATGAGTTACTCAAGAAACTTTTGGAAACCGGATTGATCGAACCTTCCGAATC
ACCATGGTCCTCTCCGATTGTAATCGTCCTGAAGAAAAACGGTCTGGACATCCGTATGCGTATTGATTACCGGATCGTCAATGGTTTTATCGAACTTTCG
AACTACCTGTTATCGCTGATTGACGGCTTACTGGTCGGATTTGAGAACGCAATGTGGTTCATGAGTTTGGATATGGCTAGTGAATTCTGGGCGGTTCGGA
TGTCAGAGCGTGCCAAGTTGATTTCGGCTTTTGTGTGTACTTCCAATGGGTGCGAATGCCGTTTGGACTATAACAAAAACGCGCCTTTGGTGTATCAGGC
AGTAATTAACAACTATTCGTCCGGCTGCCTCCAGAGGAAGAGTCTGAAGTCGACCAAGACGTCTTGGATTTCCTGAAGTTGCCCCCTCCGGCAGCCAATC
TTCTGGATGAAGATACCTAATCCGAAGTCCCGACGCTGACTGAGTACATGACTGTGTTCAAGAGGAATATCCCTGCTCCATCTCAGATGGGTCCCGTCTT
GGGACGCAGTTCCTATATCGACGACATTGCACATGGAGCTGAAACCTGGGACCAACTTTGTGATGATCTGAACGCACTCCTTTTCAGGCTGAGGTACTGG
AATATTTCCGTGAGCCTCCCTAAAAGCGAGTTCGGAAAGAAGTTGGTCCCGTATCTGTCGCATGAGATCAGTGCTGAAGGCATCCGGGTGAAAGGTGTTC
AGGACTTGCCGTTCCCAAGCACACTGGAAGGGGTACAATCGTTCCTCGGAAGTCTCAATTACTATCACAAGTTTATTGAGGACTTTCCAGTGGTAGCTGC
GGTTCTGTATGAACTCTCGGATGACCAAGTGCGTTCAGGACGTAATCTATCAAGAGTAAGGAGGCCTTTGGAATCCTGAAGCGGAAGATTGTCTCGACTC
CGTTGCTACGCCATCCAGATCGCTCCCGACCGTTTGTCATCATCCCGCATGCCAATCCGTGGGCTGCATGCGCAGTCCTCGGGCAAGAATATGATGGGAG
GATACATCCAGTCAGGTATACCGGTCGCGTCCTCAACGATTCCGAGGTGAGGTATCATGTCGCCGAGAAGGAGGTGATCGCTATCATGAGGGTGCTTCAG
GTGTTCCGGACGATCGTTGAACATTGTCCACTGATCATCTACACAAGGTACTCCGTTCTGAAGTGGGTCATCACTTCCAAATCTGCCGACGGAAGATGCG
TCCCATGGGGACTTGCGTTATCCGGGCGGAACATGGAAATCCGGAAGTTTCAACGGGACGAGGACGGTCTGGCTGCTATCATGGGCGCTGGGATCACTCC
GCGTGAACATTTAGACAAAGATGCTGAATCACTGATTCCAGCGAAAGGGGAGATCCGGCAACCGCCTGTGGTGAGTGTTGATATGTTGGATACAGATTAC
GATGGAATCGTCCTTAGTTTCGATGGAGCTGCCAAGACGTCGACTCGTCAAGGAAGCTGCGGGTGCATTGCCCGGTTGGACCGTTCTAGAAGCACACGGT
TATATTCTGAAAGATGTTACTGTGAATGACGCTGAGTACTATGGACTATTGAAAGGTATGGCGATGGCTTCCGAACGT