Description :
From Genome Similarity Track
Location :
Scaffold_1823:3924- 5434
Transcript NameFunction/comments
Phypl_g14213pol protein

Sequence
1510 bases(100 bases per row)
TACAAAGTCGAGGCTCATCGACTTCTAGCACTCGCTGGGAACGGGAAGGCTCTGCAACGGAGTCGATGCGTGGCGTACAGGTTTGACCCGCTGACATGTT
TCGCATGTCTGGCCTTACTTAGCGACCCACTTGTATCCGTTCGTCCACCAGAACGTCAGAGAGACTGCATGGTAGGTCTTCTCTCGGCCAAGATGTCCAC
TAGAAGGCACGCCGTGCACTTCGTGAAGTATATCGTACTTCAGATCCTCATCAGCGTTGCATGTGCCCGATCTTATCACCTCCGTAGCATCGGATGTCGC
GCTGTTCGGCCGTGCATAAATCCGTTGGCACCGGTCCAGAGCTAGCGACTGGTAAACTGATACCTTGAGTGCGAGCCTGTCGGTGGATGCACTCCTCTTT
GAGAGTGAGCTGAATATCCCCCTCCATCGTCGAGGCATGCACACGGAACAGCTGACGGACCTACCCGAAGGCCTTCCATGAAGACCGAGACCTTGTTGCC
TTCGGGTAGGGGGTTTCCTACCAGATATGCTGTCAAGACATGCATCTCCTGCACGTACTCCTGCTAGTCACGCCTCCCTTGCTTGCAGGAAAGGAAGCGT
GACCACTGGCGATACTCGATGTTCGCCGGTAGGAAAACGACACGTATTTGCTCGACCAACTGCATCCAGAATGAAACATTCAGGGGACGTAGTCTCCATG
GTGTAGGCCCAACGTTTAGCTCTACCACCAAGCTGAGAAAGCGTGAAAGCGACGCGAAGTTGCGCGTCCGAGATGAGACCCGCGCTCATCACGACCTTTA
CTACTCGGACCCAGAAGTGAAGGTTCTCTCCTTCCTTGCCTTCAAAAGCAACGACCGTCAGCCGCAGAGGCTTCAATCCAGGAGGCTTGGATTGAGCCGT
GGGTACTTGTAGGCTTCCCTGACTGTGGGCAATCAGTCCACGTTAATTCGTGTCGAACGCGTTCACGCGAGAGACCTGTTGGGCTGGCGTTACCGCCGCT
AAACTCCGCAGGGCTTCCAACCCAAAGATACCTCCCATCTTTGAACCGTCATCCACTGGGGGTCATTCAAGTGAAGAACCTCACTGCGTTCCATTGTGGC
TCACATTTTGAGTCCACAGAGGGTTCAGGTAATCAATCTACCGCGTAGGGGTGGATTGATTACAAGTGCTACCAAGTGTGATGGGGTCACACAGCACCTT
GCGAGAGGAAGTGTGGTTCGGGAGTATACAAACTCGCAGTTAACGGCAGTTCACaagtccctggcctgaagggACTAAGTACCAAGTAGGTAAAAGAAAG
AGTTATAGGGCTGTAGTATGGCCTGTAATACAAACTACTCGATACCTACAATGAAACGTAGAGAACCATTGATTGGTTGGATCTGAGAGCAGCTGGTACT
GTGTACCCATTACGTTGCCCtacgtggccgtggtggtgtCCACGCCACATTGGGTTATCCACACCACCTTGGGAGAGGCAGGGCATGTAGCCCCGTTCCA
GAGAGTTAAT