Description :
From Genome Similarity Track
Location :
Scaffold_43:3924- 5028
Transcript NameFunction/comments
Phymu_g2373hypothetical protein PHYSODRAFT_332764

Sequence
1104 bases(100 bases per row)
CCGCTGAGGACACGAGAGACCTTTTAATCCTCTTTGGTTGTGTTGAAGACATACGCAAAAGCCTTATTCGCGGACGCCATATTCCATGACACTCGATCGA
AAATCCATTGAGCGCACAGCGCTGGATCACCATTGGCATGttgagcaccaccacgttgAAACGAACGCGAGGTGAGATTAGGCATCGGGTTTGCTTTAGC
CTGGACTTCCGATGCAGATTTGACAATCCGTTTCACATATGCATGAATTAAACATTATTGGAGGGCGGATCGGGTTTTTCGGCATGCGATTTCCCGTGTA
AAATCATCAAGAGAACCGCTACTCAAGGTCTCAACAAGTGGAATGTCGTTTGGGGCGGAGATAGGTAGCGAAGTTCCGGGAAATAATTGGGGGGTGTTCA
AGTACTTGTGCTGATGGAAATTCTTGCATCACTATAGCCATTGCAAGAGCGTGCAGCGGGCACGTAATGAAACACGTTTTGTCCAGAAATAGAGACAGAC
CTTGTTCCTCCGAGGTTTTGACCCGGATCAGTCGAATAAACACGACACATTCAGCACTTACGGACATTCTGCTTTTGGATATAAAGTCGAGGTCAGAAGC
ACGCCCAAAGGCGTACCACATCAACGCTAGCAATGCGGCACCTTGGTAGTCTTTAGAACTAGAAGCGTCAACGTAAATCCCGTCCATCAGAATCCGTAGA
TCCTCCTTGGTACACGCTGGAGCTTTTTTAATCACCCCTCCCTCATTCCGCTTTAAACAATAGCGCTCCAGCGTTTGAGCCATCTTGAGCAGTTTCTTCT
CGATAACAGTGCGGTTCTTTGGGTAGCTATCTAGTAGCCAATTCTTGACGTGTCGATAATAGCTCATTACTGAGTTTCGAGCAAGGGGTTTCCCTCCTCT
TCCGTCTACAAAGGCCACATAGACGGCAAAACGTTCCATCAACTTCACAAAAGCGCCACCGTCGCCGTCATTGCCTAGACACGAGGCGATAAAGCTCATG
TTGACATCCTCCGATGCTAGGAAACGCTCGAACGCGTTCAAGGAAGTCTTCTGTGCTCTTTTGGAGTTAACTGAAGCAAGGTCTTGTAGTCCCATGGTGA
GTTG