Description :
From Genome Similarity Track
Location :
Scaffold_397:39234- 44186
Sequence
4952 bases(100 bases per row)
CAACTCTCAAGATCCCGTCACAGGTGACGGCAAGTACGACGCAAAGGAACTACAAAGGCAAGGGAACACACCCGTAAGGCAACCCTACGGCCAGATCCAC
GATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACAATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCC
CACGTCTCGCCAAGACGCTCAAGCTTCACCACTTGAACTCCTCGGAAGTTACCGAAAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAA
GTTCAGTAGATGACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCTGTTGGTATGTCGGATCCAGCAATCTCGCAGATTTTGCTGATCC
CGCTACACCCAATGGTGTGCGTGCCTGGATCTTTTGGTGGCTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTTAAGTGAAGATTGAGGCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTCGGGA
CCCCTGCGGATCTTGACGCAAGTCAAGCCTCTTGCTAACAAAACAAGGAAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACA
CTGTACCTAAACCCAACCCCGCTAGTCTAAGAAACGAGAAAGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAATAAG
ACCAAGCTGGATCCAGGTCTGGCTGGTCAGACAAGGATCTCGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCA
GATCCTGAATCCACGACAGATCGAAGATCCAAGAGAACCGGTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTTTG
CTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATTCGCGACGCGGGACCTCTTTGCCA
GAGCTAAGTCCATCATCGGAGAAAGGTCGCGCACTATGGATCCGGTGTCGTCGCCGAGGGTCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGA
GGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCAAGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACAGGAAGCC
CCTGTGAACGTGAAGGCTCGGGATCCAGTAGGCCCTACGCGTGATCTGATACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGACTAT
CGTCAGATCGGGCTCAAGGTAATCGCCTCACGGATCCGGTCTCGCCAATGGGCCAGACGGCCACAGGCTCTTCCGACACTTCCTAGAGCACCCTGCAGCG
GCACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTG
GAAATGGAGTCAGTGGAGGCAGACAACTTCCATGATGAGTTCGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAG
CCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGACCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAG
AACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGAGTTTGACCTTTGCGGATCTGCTTGCGGGGCCAGCCAGG
AACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGAGAGTGTCGGTGGCAC
GACAATACTACCGTGCTCGCCGCAGATCGGATGAATCCCCGCTGGAATACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGA
TGGGGGATCCAAGGTACTGCGGGAACACGTGGATCACTTCATCGAGACGTTGGAAGATGTGGATCTGGACGACAGGCTGACCCTGTTACGTCTTCCAGAC
GCAGATGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGA
CGCCCACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCTGACTCAGGAACTGAGTCAGGATCCGACGGTTCGGACTCCGACCCTGAAGATTACCG
TCGAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACCGGAGACAACTCTCGACCGAGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCC
CGAGATCTCATGGACGGGACAGCCCAGGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGT
GTGGCAAGAAAGGTCATCCCGGAGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAA
CCAGATCCGCCAATGGTTTGATCCAGCCAAGCACAGAGGGATGTTGCCAAAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGGTTGAATCCGG
TACGAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGA
TCTACATGAAGTGTCAGTTGCCAAGGTCTCTAGTTTGCGCCAAGTGGATGAGTTTTCCAGATCCGAACTCTCTTCAACCCTGGATCTACACAGAGGAGAG
GCACGTGGTTATTGGGAGAAACGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGCGAGGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGAT
CCTGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACCGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTTAGACAAGCCAA
GGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCGATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTGC
CAAGTGGATGGGAGTCGAATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGCACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTT
TGGTGTATTGGTTTGACATTTGGGTCGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCGGCCGGAGTGAGGTTGGATCTAGC
GGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGACGGCCGTTGTATATGGCGAAGATGAGGCTCATAAGGGCGGATAAGACA
ACCTGGATCGAGCCCGGGGAAACCTGGGAACTGCCAGATCGGTTAAGGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTGCCGA
CCGAAATCCAGGGACCAGGTCGATCACGATACCTCCAGGTCACGAAGCGTCAGCGACAGGAGGACTATTTACTGGCACACATGAGTGGAGGAGATTCGGA
GCGATGGTTGGCGAAGGAACGATTCCTTAGGCGACCTGAGATGTGTGTTCCATGAGGATTCCGCCCGCTACACAAGAAATGGCCCAAATTTTGGGTGTAC
GAGGCGACTACCGAGATCGAATCCCTCGGAGAGGTGGAGCTCCCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCGACTCCGCGAAAGA
TCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAATGGAGGTTGGATCCACGACGGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGT
GGATGAAGGATTGCAGAGGGCTAAAGCCGGACCGCCAGATCCCGCTGACCCCAGAGTGGATCCAAGCTTTCCATTGGATAAAGTGCCTGGATCCCTATCG
AGAGTGGCAACACTAGTCAAACCAGAACCGTCGGGCTTAAACTCGTTAGAGGACCGACTAGATCCAACTGGTGGTTCCCCTGATACCAGGGTACCTGATC
CCCCGAAGACAGAAGGACTGCCAGGCGAAAGAGGGTCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTCTGTTACCATGA
AGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATATCCAAGTG
GATCCAGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCG
CTGTCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCATAGGGTGCGGAAGGTGGCGCCTCAGTTCCGAGAAAAACTATCGGA
TCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATA
CGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAAAGAGCTGTTGGAAGATTTGGATAAAGTAC
TCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTGGGTAGTTACTATGACG