Description :
From Genome Similarity Track
Location :
Scaffold_13:39230- 44013
Transcript NameFunction/comments
Hyaar_Emoy2900067HaRxL74

Sequence
4783 bases(100 bases per row)
TTGAAAAAAAAGAAAGATGCGATTGTTACAGGGTCGACAAACGCGATCAAGAATCTCGAGGAGGAAGATCGCGTCACAGTCGCACAACGAAGTTCGTGAT
ACGAACAAGATTTTTGATGAGCAGCACATAATTTTCAACTTTCTCGTCCATGATGCCCCCCCGGTCCTCTACGACGAGAACCTACTTTACCGCCATCCAG
GAAATAGAAACAAAAACGTACGTGCAACCAGCTCCAAAACGTACAAGGAGAAGTATAAATTAAAACACCCCAGCATTACAGATGAAGCAGTAGCATCGCC
GTAAGGAAGGGTCCGAACCGTACATGCTACAAAGAGGACATACACACGGAGCAGTAAAGGCCGTCTGAGATTTTGTGGGCTTAGATAGCAACATAAACTT
TGAATGATACATTTTCTCTATGGTAGTTGCGCTGTCCGTCCCATTCGTACATATACGTAGGAGCCCCATTCTCTTGGTTTTCTACGGTTTTAACACGCAC
GGTATCGGATGGAGTCACTCATATCCGATAGATGTAAAAGTGCCACGTCTAGCTCTATTCAACAAGTCGATGCGTATCACATCCACGAGTGTTGGAAGTA
ACGGAGGACCAAGAAATTAACCACGTGCAACTGTAATGGGTACAACAAATCATTATAATGTGATATCATAGTGCACGGCAATGATAATTCTTGATTTAAT
CTGTTTGCATCATATTTAAGAACACGTCCGCTCAGTATCGGTGGCTAGCAATGTCGGTATGACACTTTATATCAGGAAGGCCTTTGTGCAACTCTGCTTG
ATACATGAAACGGTATGTAAAACCGCATTTGAAGACCACGCACCTCGCTGCGTATTTCGCCAAGGAATCCGAGCACGTCATAGAAATTTCAAGCTTAGCT
TTTGATCATTTTCATCAATCTACCACTTTAATGTACGAATCTCACTGCAGCTTCCTCATCATGTTTCATTTGTATTGCTTACAGCTTGCATTGAATGAAT
ATGGCAACTGCGTAAGCCGTGGTGGTATACATTGACACGAGCATTTCATATTGAGCCTCCTTGTTGCTAACACACTTCTACGCGTGAACATGTTGACCGA
AATTCAGTAAAACTTGCGAGCAATGTACGTGTACTTGTTACCCTTGTCAACCTAACCCTTTGGCTCACCATAGTGGCACCAAACGATCAGTTATGTGGTT
GTTGTGCATAATGACAAATAAAATGTCAGCGCTCTTTCTCGTTCCACGATCACTGGTAAATTAGAGGACTTATCAGAACATTTGCTGTATTTTGTGCGGG
TCACGTGGATCTGGTATCTTAAGCGTGACACACGTAGGAGATACAATACCGTAAAGTCGACTTAAGTCGCGACAACCTGTTCACACCTGATTTATTGGAA
TGCGCTTTGTGTTAGGTCTAACCTTATTCTTAGCTTTGCTCTAAAAAAAGAATCTTTTATTTTGGTAGTAGAAGCGTTCATCGCTTCAAGACTCGACTAT
CTTCAAAACTTGGTAGGTACTTATCACAGATTCGTGTCGTCAGCATCGTAAAAATCGTGCGACGAGTTCTGTCGAAAAATCGTTACCACTCCATCTCGAC
AGAAGAATACTTTCACGTCATTTTGTCAGCGGAAGTTGGTGGAATCTGTATATATTTTTCTGGCATAGTCCACGCATCTGATTATGATCTATTTTTCGTC
ATGCGGACTTTCGACACGAAGTCAGTCGATTGCATCAACGTACAAAACCTTTACTGATTGCTACTGTTTAAAATTGCTATAGCTAGTCCTGCTCGAGTCG
ATCCAACATGAATGAAGTCATCATAAATTACGATCTTGCTGATCGCACGTGAAAAAATAACTTTGGTGACGGGTATACAGATTCTATGCCCTCAATCATG
CTGATTTTATAGTGAATGCAGAATGGTAATTTCTCGACCACAATGAAGAAAACTCTCGAACGAAGTTTATTGTAAATGCTAGTTTTTACAAAAAGCTACA
CCCGCTCAATTCAACTTGTACGATGATGTCATCTGAAATTTGTAGTACTAAAATGACATTGTCGGCGACTGCGCCGCAGATTCAGGTGCACAAAATAAGT
GTAATTCGATACTGCTGATTCTCTTACCCATCTCACTTACATCATGAGCAGTTTCATACGTACGATAAAACACACGAGCAGCATTACCTCGTTTTCCTTT
ACCGCATCATAATAGTCAGTCCTAATGTGTCTAAAAAAATTGTCTTCACTTCCAAGTGTAAAGTAAACGAAGATCGCAAATTTGCACTCATTATCCCCAT
TTTTATTCATTCTCGCGTGTCCTTCAAAATCACCATTTTACGCCTCAATCAGGTCACTCAGCGCGCATCAGCTTACGCATCTGTTGAATCTTTTTGTGCT
GAGAAAGGTGGAGATCATGCACATTTGATGAGAGCATGTGAATCACCAGCTCACTCGTCCACGTTTAGCTTTGAAAAGTACACTACGATTTGTGGCAAAA
GAATTCACGGAGATAGCTGGGCACCGATTCTTAAACGGTTTTTGGTAGCACGTTATAATTAGCACTACGTGGTAATTGGCTGCATCAAATACTCGCTTCA
CATACACCAACAAAATCAACGCTATCTTAGGCCATAACTTTGCATCCTCTTACAATAGCGTTGTTTTCTGGGTTAAGCTCTGACCAAAAAGACACCATTC
GATAAAGTTTGTAAGGACGAAGATGGGTCTTGACAAAATGTCATTTTGGCGAGCGTCCTGGAGCTGGACGATGTGAAATTGAGACGCAAGGATGCGGCAT
TTGCATCAACTATCAAACGTATATACTGCCTATTTACTTACTCAGAAAATGAACTTAACTTGGTTCATTCAACGGTGCCCTTAAACGATTAAGCGCTGGA
CGGGGTACGTGAAAATGAATCAGCTGTTCATTAACGATCCTAGGTGTACCATGTTGATACAATAAAGTTCACGAAGGGTGCGAAGGTCGAACAGTGCAGC
TTATATAGCGAAGGTGATAACAAGTTATTAGTTAATCGCATCAACACTTTCGATCGTAAATCAGCTCCAATCCTACCTTACTAACAAGGTAGAACGCTTC
CGCCTTATTAGCAGCATCGTCGACTGGTATTGTGTGTAACGAGGTGAGTCCGTTTCATGATGTAACATGCAAGACAATTCCATGGCACTATTATCGTAGC
TAGAAAGATTAGCATATCTACCGTAGCCGATGGCTTCTAGAAGTATGCATTGGCATAAATCTCCCGATCGTACGAGATGCAGACCGCCACTTGACAAACG
TTTACTTTCTACCTGGCGTGTCTTATATTCGCCGTCACCATCGCCATGCCTGCTTTTCGGTCTCTTTCATATAGCGAGTATAGACCTTAAGTGTAGCTCC
TCCGACCTTGTTCCTGTCGCTACATACGCTCGAAAAGATTTAGCCATGTACCGAACAGTGTTACCTTTGTAACTTCATTCAGGTCATTCTCGGGTCATGT
CGTTGAGCGTACACAGCGTGGCCGAAAGTCCGGTCATCTAATACGATTTTTGGAGGTGCGTTGAGTCCTGCTGACCTCGGAAGGCGTTTACAACGATTTC
AATGTTGATGGCGGCATAAGCGGGAGCAGACGACACCAGTAAGAATCCAGTCATTGCAAGGAACGTAGGCATCACTAGAACTTGCAACCTGCGACTTTTA
CAACGTATGACGCTGGTCAGGATATGTTTTTTATGAACGAGAGAGTACGTGAGCGATATGTAGATATATACAGAGATGTATACATGCATAACCTGCCAAT
AGTTGCTGACCTAAAGCAAGACGGCGTGCCGCTTTCAAGTAGATTGGCTGATAATGCAAGAATGTCTGGACATGTTGGTATTCGAAAAGTGTCAGTAGCA
AAGCGATGAAACGGGAATGTGGTAGATAGAAAATAAGTAAAATTCAGACGTCGCTTTCGACGTTGTCGACCAATGTCGATCTTGTGCTTCGACTCTTCTT
CCGGTCATGCATACTACTAAGCACCCTCAGTCACACATTCTTACCTGCTCGATCAAATCGCTAGCTGTTCGCGAGCTTGTGATATTGAAGATATAAAATG
GGTGTTACAAGCAGGTTTCAACTTTCGATTGAGCTCCAATTGACGTGAATCTATCGTCGTGTATGTACAAGTGGTGAGGATGTCACGCAAAAAGTTTAGC
TTTGTAATGCGAATTGGAATCGGGTCCGTAGCGATGCACCTATTGCAAATGCACGTGAGAGAACGCTGACTACTGTTTCATCTACAGGTACTACATGCAA
AGCAAGTATCACGGTCAATGCGAATGCTTTGCGTTTGACGTTGAATCGAGGCGTTTCGAGAAGTACGGTGATTGACATAAAGACACACTAATCATTTATT
AGAGCCACGATACAACTTCAATCGAATGTATTGTGTGGCCAAACCAGTCCACATCATTATTTTTTTGATAGATTTGCTGGTATAAAAGACAGCGAAGTTG
GAAGGGTGGTGCAGCAGAAAGCTAATACTCTACGCAGCTTTTCTTGACCAACACGAGTTGACACATTTATGTACTCGCATCGTTTGTCAACTCGTCTCAG
ATCCTTACACCGTAACACATAAAAACCTATTTTTGATATAAAGTTTATTGAGCTTATACTGCATTCGTGTACACGCGATACTTACCAGGTCAACACTGCC
CGGATGAACCCGTGCAACTTACACAAACTGACGGGATATAGTCGCTCAAGTTTGATGAGGAGCCTTGGTCCAGACTATAAGGA