Description :
From Genome Similarity Track
Location :
Scaffold_264:3923- 8177
Transcript NameFunction/comments
Phyke_g7482hypothetical protein PHYSODRAFT_343758
Phyke_g7483hypothetical protein PHYSODRAFT_309120

Sequence
4254 bases(100 bases per row)
GTGGTCGCCGTCTGGCGTAACGTTGGCGTGGGGCGAAAACGGTCCAGGCTCGCAAGCCAGGCGCTTCGCATATCGCCCACCTCCAACGCAGTGCACACAA
TCCAGTGCCCCAGTACAGTCGGCATCTTCCCAGCCAACCGCCCCACGTCACTCTTCGGAGCCGACGTACCTGCAGCACACCACGCAATTGCAATCGTTAT
CTGCTCGTTGCAAGCACAGGAATCCAGGACGCGGACAAGATCTTAATCGCCCAGTTAGTGTAGAACAAGATCGACGACGTGACGAAcaagttggcagcaa
tgagcATGTTCCAGAGCGGCGTACAGGTCTTCATCCCAGCAGCGCTCAACCGGCCGACGCACACGCTctacagcatctgcatgttgGTGCAACCAACGAA
TCAAGAATGGACAGTGAACCGCCGCTACTCGCAGTTCTTACAGCTGCGCAAGGACATTCAGCACAAAATGGCGGCACGTGGCGTCACGTGCGCGAACTGC
GCCAGTTTCAACCGAGCTATCTGCAAATTCGACTTCCCACCCAAGTCGCTATTGCGCACGAACACCGTCGTGCGTAGACGGGTTACGGCGCTCCAGGACT
TCctcaagctgctggtcgAACGAGTGTACAATGATCTGCCCAAGTGCGGCATCTGTGGCGAAGAGGTCAAGGACATGATGCGACCGTTTCTCATTCGAGG
TGCACAACCGATGAACGgctccatcatctccaagaTTAACAAATCCTTGTCGTTGGATTCGTACGCGGTGGTGGACCAGCCCGTTGTGCCCGTGCCCGTG
CCCTCTCCGGAACCGGCGCCGCCGATCTCGCCTTCATTCACCAATAGTTCCAGGGAGCtattcagcagcagcaagtcgtcGAGCAAGCCCATTTTCACAC
ATAGTCAGATTTCAGGTGGTAAATCCATCTTCTCACGCAGCAAGGCGATGATGAGCACCCGCTCCGACGACGCGTCCACGCAACCCAACGATTCCGAAGA
CCCGTTGCGAGATTACTCGGATAGCGACGAGGACGGTTACGGCAAGAAATACGACGACCAGCGCTGCTATGATGAAGGGATCCCTCTCGAGGAAGCCATG
AAACAAGTGGTATTGCCTTCAGGCACAGAGCACACATGCGAAGAAGTGGTCGCCCGACTCACTTCCATGTGGGCCGCCTACGACCTGGATGAAGCCCTTG
CATCCTTGCCACCCGAGAGACTTTCAGAGCGCATTTCCTTCTctgtggacgagaacgaaTACGTGTTCTGAGTGTGTTGTTCAAATGCAATTTTGCTTTT
TCTTCCCATGGGGTATCTGCTAGCCGGCCTTGACGCCCCACTCGGAAGGGCGTTGTGCAAAATAAATATGAAGCAGTATAATATCAAGCCACGAACAAGC
GTGCGCTTTCAACTTACATCATCTCTGGTTTTAATTTTGCATTCCAATTTCAaccgacagcagcagaacgcaAACACGCCTACAAAACAGCATTGATTTC
ATTGTGCTCCTTGCTTGCTGGGAGGCTTCATTGCACTCATCCCAATCCCTGATTGCACATGGATCCGATTTCTATAATTTTTCGGGATCGGCAATGCCCG
TGGCTACCACGGACACCCGCAGCTTACCATCAAGGGAGTCATCGAATGTCGAGCCGAAGATAATATTCGCGTGCGGGTCTTCCAGTTCCCGGGTCACACG
TTCCGCCGCCTCATCAACTTCAAATAGCGTCAGGTCGGAACCGCCAGTGATATTTACTATCATGCCCTTGGCATCCTGCAACAAGATCACAGAAGACCGG
TTAAAAATTGCGCAAAACAAGTAACCTGGCTGGGATTCTAGCCCTTGCCTTGATTGAGATATCACCCAGAAGTGGATTCGCCAGCGCATCCTCAGCGGCT
CGCAAAGCCCTAAAAATGATCACAAGCATAGGAATCGTCAGCGTGGAAACAGGATACCACCATCTTGAGAAAATCGTATCCTTGTGATATAATATCCAAA
ACAGTAAAGCTCACCGGTTCTCTCCATCGGCCTCTCCACTTCCCATCATGGCGTTCCCCATATTTTGCATCACCTGCAAGGGCATACACATCGTCAGCAA
CAATGCAGGAGATACCAAAATGTGAGTGAAGGCGCTCATACCGACTGAACATCAGCAAAGTCGAGGTTGATGAGCCCAGGCATCACCATGAGATCGGAGA
TGTTCTTTACTCCATCGAGCAGAACATTGTCTGCCATCCTATACATTCAAAAGGCACCAGCAATCGTTAGCCACGTTACCAGAGATGAAATTCAGTTGAA
CGCAATAAATAAAGCAAGTAATAGAAGCTACCTACCGGAATGCATCCATTAGAGATGTACGCTCGTTTGACATGTTGAACAAATTCTGGTTCGGAATCAC
AAGCATCGTGTCTACACTTTCTTTCAGTTCAGCTAGGCCTTGCGCCGCAAGCTTTGCTCGATTACTGCCTTCGAACCGAAACGGCTAAGAGTTCACACAC
CAGAAGTCAGTTTAGTGTCGAAAGTGTCATTGAGGCAGTAGATAGATAACACCGACGTAGCTGAAATGTATGTACCTTGGTAACAACCGCCACTGTGAGA
ATACCTGCTTCTAGAGCTGCCTGGGCGATGACGGGTGCTGCACCCGTGCCAGTTCCTCCACCCATACCCGCAGTAACAAACATCTGTATTGATGCAAATC
CGGTAACAGTTAACAGTGAGAAATCTTTGTGATATCCAACCCAACAACCCATCAACGCAGCCAGAGTCTTGCGCTATATGCTCGGCAGAACGCACCATGT
TTGCACCTTGGACACGGTCCAAAATATCATCAATTGCTGCTTCCGCTGCCTCCCGACTAAATAAAAAAACGAATATTCAATTCACATACATGTGATATAC
CCATAACCAAACTCAAATTTCCAGCCACAAATACCCACCCAACATCGGGATTGGCGCCACATCCAAGTCCTCCCGTCAGATCGGGACCCATTTGAACACG
ATTCTCCGTCAACGTCGTGCGCAAGTGTTGTGCATCCGTATTACACACCATGAACTCCACGCCCTGCAGGCCTCTTGCGATCATATTGTTCACTGCCATA
TAAAATGCACATCAACACAATGCATTCCTGAACCCAAAATTCAAGTCACGCGCACAAACCTGCATTccctccagctccgccaACACCAACGACCACAATT
TTAGGAGCGAAGCTGGACAAATCCGTGACAGGGTGGTCCTGTGTGAGCCACAGCGGTTGTGTGGAGCTCATCGTAGGCggcacgagcttcttcttctcca
ctACCGGCGGTGGTACAGCGCTCATGTCCGTCGGAGACGCAGGTTGGTCCTCGCTTTCAACCGTCAAAGGTTCACCGTCAGCCTTCTGAGCCTTCTTGAA
GCCCTGTTTAGTAGTAGCGAACATCCAAATGAGAGACGGAATTGAGTCGTTGTGCTGCTAATATGGTGAGTTTTACCATGCGCAGCGCCGCGGCAGCTGC
ATCTGTAGCTTCTGTGGAGAAAGCAAGGCGCTGAGTAGCTGCCTGGGAGGCCTGTCGAACATGTAGCAGCGCCGTCGCCGTTGCCTTCATGCGGGAAATC
GCCATGGGAAACTTTGGTCGGATCGCCACAAAATGTGAGGAAAGGCTATCTGAAAGGTTGTCAAAAGTATAATAAGCTATTAGACAGGTTATAACTAATG
TTGTTATTGAGCGGTTATAATGTTGCTGATTGGCGGCGTTCACCCCTAAGAAACCTTTTGCTCAAGATGACGTAGCTCTTCAACGTTCGCCTTGATGCAG
AGTAACACTTCCGCCTCCGTTAGATCAAGTTGAATGCCGTAGTTACGACCCACAAAGGTGCTGAAAACGTCTACATCCGAGCACAACAGTCGCCCAGTGT
CGGTCCAGATCGCCACGTCGCTGATCACGAGGTTCGATGACGTtggcaagttgaagctgcagtcaACCACATCGTTAGCAAGAGATTTTGAAAAGCAATG
AGCTGTATATagatgttgaagacgcacCCGTGTAGACGCATCAATTCAACTGCATCGCTGCACCAACGGTCGGCCTTGGATGGTAGTTTGGTCACTTTGC
AATCCGGTAAGGTCGCCGCTAGGATGTCTGCAGTATAAGAGACCGTCAGCAATTCaatcatgaagaagagagtaTAGCGCTACGTACCAAGTAGTCTGTC
GCAGATGGCATACTCTTCACTGCTGACCCGCCCAGCGAGGGTGTAGTGCACCAT