Description :
From Genome Similarity Track
Location :
scaffold_127:3923- 5862
Transcript NameFunction/comments
Pl_109141conserved hypothetical protein

Sequence
1939 bases(100 bases per row)
CAAGCGTCTGTAGAGCTGTCGGAGGTGCGGGCACTAGCTCCCTTTGTCAGCTGTGGTAGACAGCTTGTACCGATCGTAGCTTAAATAATTTAGAAACAGC
GAGAAATTACATTGCCACTGTTAGTGTTGGGCTGATTGCCTGGTTGTTCTGAATTCACTCACAGCTACGCAAAAGCTCGAGACAAAATAGGAAGCATCGT
TACAGCAATTGCAGTGAAGCCGAGAAGTGAGACGGAGTGGCCGTCTCTTTCGAGATTAGTGCCGCTTCCCGAGAGCATGATAAACACGCTGTGGCGACAC
GTGTCAATGGTCTAGAAGCCTGTCGAGACGACTTCTCGGTGCGCCACTTGGACAAGACCTTTGGCAACCGTTTGTTGCGGCGTGTCGAGTGCACAGGCAG
CCTAAATCATCAGCTATCTGGCATGACATTGCAACCTCGGCTTTTTGACGCAGACCTTTGACGCAGACCTTTGACGCAGACCTTTGACTCAGCGACAAGC
CGAACACACAAGCATGACACAAGGAGAAACCTGCCGCCAACCTCGAAGCTGATCCTCTATACTTAGAACTGCCGAAGCGTCGCGCAGGGAAAATGCCGCG
TAAATCCGAACAATAACGGGCCGTTTCGGGGCCCTTACTCAACCCAAGTCAACTCTTCTCGGCGTGCACACCCTGTCTATTTTAATACCCTGCTACGGCT
GCTATCAGCAACCACAGTCATCGATCCAATGGTCATTTCTTATATCTAGAACCTGCAATATCGTATCTGCGACAGGGGTGCCAGCGTCGTCAATCCTCTC
AGAACGTATAACTATTTCCCTGGATCTCCTGCTTCATTTCCAAAGGATCTCAAAGCGGCACACTCGGTCACTTCAGCTACCGCAGCCATGGATTACCGCC
AGTACCAGGTGCCGCAGCCATCCAACTCGATGCTCTCGTCCGCGCGGGGCATGGCACGTCTCAACGGCAGCAACCGCGCCGCCTGGAACGCCATGGACTT
GGAAATAGGCCCACAAGCGCCGCCTCCTAATGCCCGCAACGCCCTCGAAGACGACCGCGCGCTGTCCGCTCGCAATATCCTACTACGCCAGAAGCTGCGC
GAGCGCAAGCGCTACGACTCGGCGGACGACGCCATGAAGAAGGCGGCGGCACGTGCAGCGAATCGGTATCAGCCCCAGACTCAGACGCAACAAGTGCAAG
AACCTCCGCAGAATCAGATGCAACCGAGCCAGCAGCCCTTGTCGCCGGCTCAGATCGGTCAGTCTGCCTTCTTTAATGCCATGCAGAGCGAGAGTCCAAA
GCGCAATGTGCAGCGCAATGTGCAGCGCAATGCACCGACGTCGCGGTTTGAACCGTCTGGAGGAGCTGAACAGGGACGGAATGTGCTCATTCAACGCAAA
TTGCAGAGCAAACAATCGTTCGACTCGGCAGATTATCAGATGGCTAAGGCTCGACGCGGACAAGAGATGGAAGACACGCACATGGAAGATGTGAGTGAAG
CAGAACACGCCAAAGAAGAAGAGGCCGCCAGTTCGCCTTGTGCGTCCTTAACCAACGCGAGTCGGCGTCAACAATTTGCTAGCATGAGTCCTAGTCGTGC
TGGCAAGTATGGGGCGTTGGAGAACAAGAAGAAACCTAGTCGACGAGATTTGCTGGAAAAGCAGCAAGAGGAAGACCCTGCTGAAAAAGCACAACAACAG
GGATCTAACTACGGAAAGCTGTCGGCGGCTCATGTGCTGATTCGACGCAAATTGAAGGAACGGAAACGTTTCGACTCGGCAGATTATGCTATGGAGAAAC
AGGGACAGCCGACGGATGTGCCTGCTGATGTCGCTACTAACCCTGCGGCTCCAGTTGCTGGAGCTGTGCCCTTTGGGGGAGCTTCACAGGCGTCTATTGA
CCACCAGGTGAAACACATCAAGCTTTCGGAGGACCCCAG