Description :
From Genome Similarity Track
Location :
contig_122:3922- 8276
Transcript NameFunction/comments
g11413.t1pol protein

Sequence
4354 bases(100 bases per row)
TTACCTGAAGAGTGCCCGTCACTCTTCCGAGTTGGTACATGGTGTACCCAACACCACTGACACGTGGTGGTGGCTCACAGCCACCCATACATAAAACATA
TAGGATAAACTATAGTTGACTTAGGAATTGTATTGCAAGACGATCTCTAGGTAACTAACTATAAATATATCAGTCTATAAACTACGTTGTCTAAGTCAAC
CGTTCCCCAAGACCGGGAACTAGTGAACCGTCGTTCACTTGGAGTTTGTATACTCCTAGCACTTCCTCGAGCGCAAGGTGCTGTGTGACTCCCGTCACAC
TTGGTAGCACTTGTAGTCAATCCTCGCCTACGCGGGTAGATTGGACTACCTGAATCCTCTGTGGTCTCAAGCATTGAGCCACCATGGATCGCAGTGAGTT
TCCTCACTTGAACGACTCGCAGTTCGAGTCCGTTCGGAAGATGGCGGGCATCTTCGGGATGGATGCCCTCCAGAGCTTGGCGGCAGCAACACCTGCCGAG
CAGCTCGAGCGCGTAAGCGCTTTCGACACGTACGAGCAAGGGCTAATCGCCCATGTACGTGGGAGCCTACAGGCCCCTGTGGCTGAACGGAAACCAGTTC
AGCCCAAGCCTTTGAGGCTGAAGGTTAACCCCTACGAAGGAAGGAAGGGGAAAACCTTCACTTCTGGGTCCGAGAGGTCGAGCTCGCTATGGACGCGGCT
CTCGTCTCGGACGAGCGACTCCGCGTCGCTTTTGCTCTCTCCTTAGTGGTCGAGCAAAGAGCTGGGCGTATACGCGCGAAGCGACAACGCCTGGATGCTT
TGCATCCTGGGCTCAGCTGTGTGAGCAGCTTCGAGCCGCCTTCCTCCCGGCGAACTATGAGTACCGCCAGCGCTCACGCTTCCTTGCGTGCAAGCAAGGG
AGACGTGAGCTGCACGAGTACATCCAGGAGATGCGGGAGCTCACCGCATCTCTGGTGGGAAACCCACTCCATGAACACATCAAGGTGACGGTGTTCATGG
ACGGCCTGCGAGTAGGCCCAGCGCGCACGCAGCTGTTTCGGGTGCAAGCAAGCACCCTGGAAGAAGCGATTCAAATCGCTCTTCAGGAGGAGTACAGCCA
TCGACAGGCTCGCACTCCTGCCACTGCGTGGCTTGGGGGCTCCACTCAGGGCGGGCCCCAAAGTAGAGGCCCCTTCAACGGTCCTGTGCCGATGGACCTG
AGCCTTGCCGAACAGCACGACATTCGCTGTTTCGGCTGTGGCAAACTGGGGCACATGAAACGTGCGTGCCCCGCGGGAGGAACAACACGGCGGTTTCCTC
CCAAGCCCTTTGGTCCTAGGGGTCGCTGGCAAAAGCCGCGACCCCGTGGCCAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAT
CTAAGTCTTCATGAGTGGTGCGCGGGTGGTGCGCACCATGAAGGCTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGAGGGCTGC
TTGTAGTACATGCAAGTGTACGGGGATACGATCATCCCATGAGAATCTTGATCGATTCTGGGGCGTCAAAGAACTTTGCACGCCGCCGGACGGTCGCTCG
CAAGAGCGACCAGTTCACCGATGCTTTACGAGAAAGCAAAGGGAACGGGCATGTCCTAGTCAGACTGGCTGACGGGACTGTAGTGGAGGTGCCCAAGGTC
TTTATGGACCTGTCCGTCAAGTTTGAGGACTTTAATTCCACTGAACCGATTCCTCGTTCTTGATATGGACAAGTACGACTTGATCCTGGGCATGCCATGG
CTTGAGAAGCATGAGCCCTGGATAGACTGGCGCGGCAAAGCCATCGGGGCTAGCCGGCCTGCTGCTACTGACAGAGCATTGGTGAGTCATGTTCCCACCT
CTGTCAGCAGCCGGGCCTACCACCGGAGCCGAGTCGGAAATGACTCCGAAGAATTAGTTGCGGCAGGAGCCGCAACAGGTGTCATGACACCGTCCACGCG
GGCAACGGACCGCCACAGGCAATGCCGGTGGACAGGACGTCGAGTCCAGCGAGGGGAACTGCAATGCCAGCAGTACCCACCGCTCCTGACTATGGCACCG
TACGGCCTTCGGCCTTATCGACGCCGGGGAAGTCAACTCCCCAAGGGAAACGAGCCCACGTGAGACCAAGGAGGTCGAGACCGTGGCCAGGGTCGAGGTT
GCTGGGAGCACCTCTGGTGTGGGTAACAATGTGCCACACGGAGTCGATGGAACTCCCGACTCCACCCTTGAGTCACCACCGGCTGTGGGTAACAAAGGAC
CATGCCGTGGTGGGCATCGACGACGTCGTCGCCGCCGTAAGCCGAGTCTGTGAGACAGACTGGAGTCGCTACAAGCGACTCGGAGAGAGAGAACTCTCCT
CAGGCACGGCCGGCCGAAGAATGCTATCACTTCTTCGACGGCGAGACCGGGTGTACGGTCAAGGCGGGCTCCACAACGTTGGCAGCCCTGCCTGAGGTGT
CAGAGCTACTGAACCTCGAGGAAATGTCGATGGACGATTTCCTGGCACAACTGAAAGCCGGGCAATCGCGGAGATGGTGCTCCTGAAGCCGGAGGCCTCT
CCAGAAGAGCTGAGCTCCTCTTCCGTTATGGACAAGGATGTCCTGGACGAGCTTGGCAAGAAGCGCGCAACGCGCACGGGCTCTGCGATCCTCGAGAACC
CCAAGGATCCAGTGTATCCTTTGGTGAAGGAGTTCTCGGACGTGGTGTCCAAGGACCCGCCGTCCCAACTCCCACCTGACCGAGGAGTTAGGCACGAGAT
TGATCTCGTGCCAGGCACAAAGTACTGTGTGACCAGGCAATGGCCACTGCCTCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAGGCAAAG
GCAGGCATGGTGCGTGAGTCGAAGTCTCCGCACTCGACGCCCACCTTCTGCGTTCGCAAGCCGAACGGGAAGTGGCGTCTGGTTCATGCTTATAACAAGC
TGAACAGCGCAACGGTGCCCGCCCAGACACCCATTCCCCGCAAGGATGTGTTGTTGAACAACATGGCGGGCTGCGAGCTTTATAGCGCGCTGGATCTGGT
GGATGGATACTACCAGATCCTGATGCGCGAGCGCGACATCCCGCTCACGGCGGTGAGCACCCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCACAG
GGCCTATCAAATGCCCCAGCGACTTTCAATCGCTTGGTCACACAGTTGTTTAGACCCTTGCGTGCGTTCACGCAGACGTACTTTGACGATATCTTCGTCC
ATAGCCGTGCCGGGGAAGGCAAGACGGCTATCGAGGTGCATCTCGAGCACCTCCGTCGAGTGTTTATGGTCATGAGAGCAAACAAGCTCTATGCCAACAT
CGACAAGTGCGTCTTTGCGGCACAAGAGATCAAAGTTCTCGGCTGCTTCGTCAGCAGCGTCGGCGTTCGAGCCGACCCTGAGAAGGTCAAGGCCATTGCG
GCCTGGCCCACACCACGATCCCAAAAGGATCTTCGCAAGTGGTTGGGTCTCGCCAACTACTTGCACAAGTATAGTGCGGGGTATGCCGGGCTGGCACGAC
CCCTGTCGGATCTCCTTAAGAAGGATGCCGACTGGCGCTGGGAGAGCCGTCATCAGGATGCATTCAACAGCATCAAGGCGAGCTTGCAGCGCGCGCCGGT
CCTGGCTTTGCCGGACGAGACAAAACCGTTCAGCGTTGTCTGCGACGCCTCCGACTATGCCATCGGTTGCGCGCTGCTGCAACACGACGCGGACGGGCAC
GAGCGAGTCATCTCGTTCCAGTCCAGGCAGCTTAAAGCCGCCGAGAGGAACTACCCTGTCCATGACAAGGAGCTCCTCGCAATGAAGTATGCCCTTGTCA
AGTTCCGGGTACACCTCCTGGGCTCTGAGCCCTTTGTGATCTATACAGACCACGCGTCCTTGCGGACGGCCACCAACTCTCCGCATCTGTCTCAGAGGAT
GGCCCGCTGGCTGTCATTCTTCGCGGAATATAACTTCCGCGTCGAATACAAGCCGGGCAAGCTGAACGTGCTTGCCGACGCGTTATCCGTCGACCCGACT
ATGAGCTCGCGCACATTAGTCGGGTTACGACAGATCTGTACGATCGGATACGCCTGGCGTATCGAGATGATGAGAATCTCTCCCATCGTGCGGTTCCTCA
CCGCTGGCAAGGAGGCCAAGCTGCATGGCTAACGCCCCGCCATCGTGCCCGACTCCATCGCTATGCGTGGGTCGATGGCCTCCTCCACTACCGCGTGGAT
CCGGCCGATCCTCCGCGGATAGTCGTCCCCAACGACGAGGATCTGAAGTATGAC