Description :
From Genome Similarity Track
Location :
Scaffold_281:3921- 7363
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_281-snap-gene-0.13VAMP (Vesicle-associated membrane protein)-associated protein A
Pytir_DAOMBR486maker-pir_contig_281-fgenesh-gene-0.5IDS4

Sequence
3442 bases(100 bases per row)
ATGGCTGACGTGGATGTATCGCTCGCGCCGAACTCGAGCGTGATCCTCGAACCGGCCGAGTCGCTGTCGTTCCATCTACAGCCGCAGGCGGCCCCGCAGG
CCGTGCTCACGATCCGCAACGTCTCGGACAGCCGCAAGATCGCGTTCAAGGTCAAGACCACGCGGCCGCTGCGCTACCTAGTGCGTCCGAACCAGGGCAT
GCTCGGCCCCAACGGCACTGCGTCGATCATGGTGATCCTGCAGCAGCGCGATTGCGACGAGCTACTGCGCCTCGACCCGTCGGAGCGCCAGCTCTCGAAC
GACAAGTTCCTCGTGCAAAGTATTTTCGCAGACGACAGCTTTTATGAGCTGGTGAAGACTAAGTCGGCGAAGGAGATGGCGGACGACCTGACGAATATGT
GGGCTCACACGGATAAGAAGAGCTTGTCGAACAAGAAGCTGCGCTGCCGCTTTGTGCAGGACGACCTGCAGAGCGGCGCGGGTGCGAGTGGAGGATCAGC
CAATGCGCCAGGGAACCTCAAGGCCGAAAGCCCGTTGTCCTCGCGGTTCCCGTCGAAGAGCAGCATCTACAGCAGTAGCAACAGTCTGCTGCCGCCGAAG
GTGAGCGTTGGCGACGAGCCAGCGGCACCACCAGCGAGACCGAGCGCGCATTCGGACGTCGAGATGTCCACACCCGCGCAGTTGTCGGCTGCGCTGCTCC
AGGACTCGTCAAATGAGAAAGCAGCAGCACACAAGGCGGACAATAATGCGATTGGAAAGGTACGATTCTCCCTATTTAGCCATTTACAATGATGCTCTAA
GCTTATTGCACTAAACTTAACGACTGTGATCTGTGTACTTCTTACAGGATGCGATGTCGGAGGTGGCGGCTTTACGGAAGAAGTACGACGAGCTCGTGGC
GTTCACCGTGCAGCTCACGGCGCAGCGTGACGTGCTCATGACCGACTTGGACAAAACGCGCGGACTCTTGCAGAAAGCGAGTTCGGACGCGCAGCGCGCA
AAGAAGCTCTACGATGACGCACCCAACGGCAACGGATCGACGCTGCGCCAGCGCAAACCCGGCGCGGCAGGAAACGGCAGCAACAGCGACGACGCGCAGC
TCTCGAAAGCAGCCAGCGGCGTCAAAGACCCAGCGGTGAGTTTTGTTACTTTGCTGTCGTACTCTATTGGTCTTCGCATGTACTGACCGAGTGCTTCTCA
TTGTGTTATATCTGTATAATGTTGTAGGCATTTGGCTTGTTCCATTTACTTGTGTGTGCAATCATTTTCTTTTTGGTGGGCCGCTACGCGTGAAGCATTT
GATAAAGAAGAAGAAGAAGACGACAAGTTTGGAAACTGGGGAGCTGGCTGTTGGGAGCTGTCGGCGGATGATAGAAGCTTCAAACGGCGGCAACGTGTGT
GGGGGCGGGTTGAGTTGTGTGTCCATCCACCCGAGCCACGCCTTCCTGACGACCCAAGCACCACCAACAGTCAGCAGTAGGTAAGCAACGAAGAGAGAGA
AGAAATGACAGAAAGAGAACGAAACTCCACGGGGTTTGACTGTTTTGCATGTTCGTGCGGCTCTTTTGTTTTTTGTTTTGTTTTGTTTTCATTCTATCTT
CCTTAATACTCCATCCGTAATCCACCCATCCATCCTACCTGCTAGTCTGCGTCTCTTGTCTTTCCTACGGGACCGGGACCGGAACTCCATTCCACCACCG
CCATGAACCATTGTCCCATTATCAACACGGTGGCTCGCTCGCTTGTCTGCCGTGCTGGCCTAGTTGAGAATCGTCGCGAAGCTCATCTTGCGCTTGCCGT
TGCTGCCGCCGACACCCGCGAGCGGCACAAAAGCCTTGCGCTTGAATCGCCGTCCGTCCGGTCCGCTGCTGCTGTTGCCGCCATCGCTACTCATGCCGCC
CTTGCCCGCCAAGCTCTCCTTCATGGACAGCATGGCGATCGCCGCCGCATCGCTATCCGAGTTGTGCCCTCCGCCGCGCTGCAGCTTCTTCTGCTGGGCC
AGAGGCGTTGCATCTACTATCGATGGGTTCGCTTCCACTGCTCCCGCTGCTCCAACGCCAGTCTCGTTCTTCCCTCGTAGCGGCATCAACAGTGCTGTCG
CATTGCCACCGTCATCGTCATCATCGTCATCATCCTGGAACGTCCCATCGTCGTCGTCGTCCTCGCCGTCGTCGTCCTCGTCGCCATCGTAATCGCCGAC
ACTTTCCAGTTTCTTGAGCTGCCAGGCATCGTCGCGGAGCGCGTGCACTTTCGTGAGCGGCACCGAGTCCTCCGAGCGCGGCGACAAGTCGCGCGTGTGC
TGATCGCCGCTATCTGCAGTGTTGTACTCCCCATACGTTGTCTCTCCATTTTCACCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTC
TCGCCCTCCCGTCGGCGGCGGCGAGTTCCCTGGCGTGTGATAACTGTTCTGATTATTCGATGGCGACGACGTCCTGGATCCGTTGTTGTTGTTGCCGTTG
CTGCTGTTCCTGCTACTGCCGTTCGTGGAGAACGAGCCGCCGGCGCCGCCCCCGCCGCGACGTCCGCTCTTCTGCGCGTCGTGCGCCTCGATGCTCGAGC
CCGTTGTCTCCATGAAAATGTGCTCCAGGCGATCGATCATCTGCAGCAGCGGCACATACGTCGCAAATGGCTGCTTCATCAGGATCGTGTGCATGAACTT
GTGGCGCGTCGCGTAGCCCGTCCACTTGTCGTGCTTCTTCAGGATCTTCGAGATGCCGCAAAAGTTCATCACCGCAAAGTTCTCGAGCAGCAGTAGCTCC
TTGTAGAGCGCGACACAGTTCTTCATCAGCTCGGTCTTGGTCTCCGGAGTTGGCGAAGACTGGTGCAAGGAAATATATTCATTCAAACGAAGCGCTATGT
GTGAGCACCGCTCAAACCAATCGATGGATAGGTTATTGCAAGCAACGCTAATGAATAAAACCCCACCTTGAGCTCGTTCGAGAGTTGCTCGATCGCCGCC
ACTTGGCTCGTGTGCTTGGCCTGCTCCTGCACGAAAAAGTCCGCGATCTTCTTGATCTCCACGCGCAGCGTGCGAAAGAAATTCATCTCGTCCGGCGATT
TGCCTATAACCAGAGCACAAACGAAGGACATTACATTCGATGAGCATTCAGCACAGTCGATCCGCGAGCAGTGCAGCGAGAGATAAGACAATTCATCAAA
TGGGTAAATGAATAAACAATACGTACGGATGCTGTCGTTGTCTTCCTTGGCGGACGGCTTGATCTTGGTCTTCACGAGCTTGTCGCCCTGCAGCTTCTCC
TCCTTCTTGATGTGCGCGCAGTCCTTGATGATGTGCTTGAGCTGCTTGTAATCGACCCAGTGGGGCTCCCACGAGGACGACGACATCTGCATCGACTGTT
GCAGCACTTTGCCGAACTTCATGGTTGCTCTGTTCTTTCGTT