Description :
From Genome Similarity Track
Location :
Scaffold_636:3921- 5288
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_636-fgenesh-gene-0.0Transient receptor potential Ca2 channel (TRP-CC) family protein

Sequence
1367 bases(100 bases per row)
GTTCTGGTCGTTTGCGCGCTCGACGATGAACCCGCTGCACGAGGCGTGCCGCCAGGACGACGTGCGCATGTTGGAGATTCTGCTGGAGGCCGGACTGAAC
CCGAACTTTCTCGACAAGGTCGCCGGCGCGTCGTTCGACCTGCAGCTGCTCTACGAGATTTGCCAGCTGCGCATGAAGAACATCACGCACGTGCTGGGCT
CGCCGCTGCACGTTGCGGTGCTGAAAGGCCACACCGAGGTGATCGACATGCTCGTGCGCTACGGCGCGAACCTGGACGTGGTGGCGAAGACCAGCTTCTT
TTCGCACTCGATGCGTGTCACACCCGTGTTCCTCTGCGATTCACCGGACGTGATCGAGAGCCTCATCCGCCATCGCGCCAACATCCTCGTGGTGCCAGGT
AAGGGCAACGCCATGAGTACGACGGTGTTGCAGCTCGCGCAGTTGAAAGATCGACGGGAGCTCGCGTTGGTGCTAGAGGAGTGGGGAGCGGACGTGGCGC
TCACGCCGCTGCACGAGGCAGCAGCTGCAGGTGACTTGGCGACTGTCAAGCACCTGCTCGCATGGGGCATCGACGCCGATGAGCTGGGCGAGTACCAAGT
TGGCGTCCACCGCCGAACGCCGTTGCACTGGGCGTCTGTCATGGGGAGACGCCCCGTGATCGCTGAGCTCATCAAGTGCAATGCGGATGTGAATGCGCGC
GACAGCTTTGGACGAACACCGCTGCACTGGGCGGCACGCCACAACAACACGGGGGCGGTAGAAGAGCTGCTCACCCACGGCGCAGACCCACTACTGCTCG
ACTGCGATGGACTCACCCCGCTGGCGTTCGGTGTCATTGGGGGCTTGGTTGGCGGAAAATGCGTCGAGCTCTTTGTCCAGCACGGTGTCGAGATTGATGC
GAACATTTTAAACGAGTACGAAGACACGTGTCTACACTTGGCGCTTCGCCTGGGCCACCGCAATGTCGCGCTGGCGTTGCTCAAGCAGGGCAAGGCCGAT
CTGTACGCTATCAACGGACTCGGTCGCAAAGCCGTTGAGTGTTGCGCGTCCGCTGAGCTGCAGTACGCGGTCAAGGTCGCAGGCAACTGCGTAGACGTGG
TGCTATCGTTCGATCCGGTGTTCCGCAAGTTTGCAGACCGCGTGCGCCGCGGCATTGAGGATCATTTCATCACGGTGTACATGCGCGATGCAGCGGATGA
CGGCAAGCGCTCAATGAAGGAAATGAAGCACGCGTCGGCGGTGGTCTGCGTGCTCAGCACCGGCTACGAGAAGAGCAACGTGTGCATGGAGGAGCTGTCG
TTCGCCAAGCAGAACCAGGTGCCAGTCGTGGCGATCTCGTGCGAGTCCATGTACTCGGTGCCGGACG