Description :
From Genome Similarity Track
Location :
Scaffold_110:392- 4938
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_110-snap-gene-0.15Conserved gene of unknown function
Pytul_var.sporangiiferumsnap-pug3_contig_110-abinit-gene-0.72ZP2
Pytul_var.sporangiiferummaker-pug3_contig_110-snap-gene-0.17Gene of unknown function

Sequence
4546 bases(100 bases per row)
CAAGCGGATTTGCAACTGTATCTTTTTCGTGCTGCAGTTGCAAAAAAGATTTGTTGCGCGGTCTTCTCGCTCACACAGAGTGAATTTTTGAAATTCGAGC
CCCAACATACAAAAAACCTCCTGTGTCCGACACTTGGAAAAACCTCACAAAAGAACACGAGGTTCTTTCGTTCGTCCGCTTCCACGTTGGCGGGAACGCG
GAGGGAAAGGGGGGAAAAGAGAGCGGCCGGCCGAGGTTTTTCGAATTAAACCCCTCTCTCACTCCGAAGCCGTGCGCGATTTAAAAAACCGCCCATTTGG
GGTTTTTTCGTGCGTCGACATCGCCTCTGCCTTTTTGAAGGGAGGGAGGGGGGTGCCGCCTGCGCGTTTTTGTATTGAGTTTGGCCGTTTAAATAAAACC
TCCGCCGCGCCTCACTGCTGCTTCCTGCGCGCGCGCCCGCACTCTGTGAAAGCGAGCGAACGCAGACGCGCAAAGTGCGAGTGAGTGAGTGAGTGAGTGC
GTGTGTGTTCGAGCCGCGCTGCTGCTACTGCTGGAGGCCGCTCTCGCTGGTTAGTTCTTCGCGACGCCCAGTGGCTCCGCTGTAGCCGTCCGATCACGTC
CATAGCACCCTCTGGCTCTGGACGACCAGGTACGAGTTGAAACGCGGATTTGTGTATGTGTGTGCGTATATATGCGTGTGTGGATGTGCATGGAGGTCTG
TGTGCTGTTTGTGAAGAGCGTGGTGAGTGGGGCTGGTTGGTAGATCCTGTGTATCTTTGTGTTTGTATAGTAGTATGGAAGTGTGACAGGGAGGTCCGGC
GTGGATGGGTTCATGAAAAGAAAACCAAGACACTTTTATTTTTTAATGTTGGTCACTAATTGATATGTTTGTGTTGTATGGATATGCGGTGCAGACGGCG
CTATCCTTATTCTCTTTTTGTGGTTAGGCTCATTTACTAGTTTGGTATTTAAACAACACGCTGACGACGTCGACGACAGCCATGGATTCGTTCGGCTTTG
ACTTCGCGGGCAGCGATCTGCTCGACTTGGGGTCCCTCGGCATGTGGGGCGGCAACTCGACCCCATTGGGCTCGTCGCCGAACGGCAGCGGCGGCAATGG
GCTCCCGTTCAGCTTGGGGACGCCGACGGGAGTTCCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATGATTTCA
GCTTTGGTGATTCGCCCAAGGCAAGCCCTGGCACGCGGAAGCCTGGGAACGACAACAACAATAACAATAATGCTGACGATCTCACGAGCCCATACTTTGG
CTCGGAATTAGAGTCAAGTGGTGCAGACCAAAGCGGTGACAACAACAACAGCTCAGCGGGCAACAATGCCAAATCGGAAGACGCCAGTGCTAAAGACCAA
GGAGCTGCTGCAGCGCACCAACGGAAAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCAACGATGGATCGGGAGCGACGACGGCGAACACCA
GTGCCACGACCGCATTGTCAACAGCCACGGGTAACTCTACCTCGTCGTCCGATCCAAGTGGGATTTCCTCATATTCAATGTCGGACCAAAATAGCAACTC
AGCTGGCGGTTCTGCGGGGCAACGTGCGTCGACCTCGTTCCCAGCGGGTACGAAACCAACCGCATCGCCTGGTCCAACGTCCGCTGCCGCCAGAAATGCT
ACTTCTTCTGGAACATCGACGACTGGTGCACCGTCGACTGGTACTGCGACATCGACTACCTCTACTCCAGCGTCTACAAATGCGTCTTCAGCAAGACCTC
ATATTGACGGACCTTCCATGTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGACGGCCTGTAGTGACCGCAGCTCAACAACAGCATCAA
CAGCAACAGCAGCAAGCAATGGCGCAGCAACAACAGCAACGGTATCCAAACCAAAACCCGAATGCGATGATGATCAACCAGGCTGGTCACGCTGGGCAGC
CAAACTTTGCTGGCCAAGCGTACCAGATGAATGCTCAAGGGAACCCAGTCATTGCAGGCCAGCAGCAACCTCCTGTAAACGGACAATACATGCAGCCTCA
GTACCGAGCTCCAACGTCCAGTTACGATGAAGAGTTCATGCGAGTGAAGGCGATGATGATGCAACATCCTGATTTGATTCCACCTCCAATGGAAGTTTTG
CGTATCTCGATGAGTCAAAGTGCTCCGAACCAGGCGATGATGGGTGGACCAGGTGCGAACTACATTCAGCAGCGTCCTGGGCAGATGAATAGAGTAGGAA
CTGCTGGGTACCCTCAATACGGTGCTCCGAACCCGAACATGATGATGCCACCTCAAGCTCAGCAACCAGGAATGGACGCCAGTCGTATGCGCGCAATGCA
ATTAGGCCAACAGCAACCGCAACAACAACAGCCGCAGCAAAGAGGGCAGATGCCCCCACAGACGCGAACGCCTGGTGGCTCGAACTCTGGAAGTCCCGAG
TCTCAAACTGCATGGCAATCTGAGAACGATCTGCCATTGCGACGAAAGATGATTGGCAAAATGTACGTTGACGACACTATGCGTGCTCTCGTGAGAGGAT
TCACTCTAACTTTATTTTTTGTGGTGACACAGTGTTAGTTTGTTGCAGCAGCGAAAACCCGACGCCCCAGCTGAATGGATTCGCCGACTTCCAGACATGG
CAAGACGACTTGAAGATTCTCTGTATAGAACAGCTAAAAATCGCGATGAGTACGGCGACTTTTCATCCTTGAAGACCCGTTTGCAACACTTGGCCGTGAC
GATGGGAGCACGTGCGCAGCACAAGGCTGGAAATCCCCGAGCCCCAGCAGCGATGCCGAATGGCGCCGGTATGATGGGAGGTGCTGCAGTACCCACGGGT
ATGGGTGTAAACCCTGCTGTTATGGGAGCCGGAATGCCGCCTCAGGGACATGTCGTTGGGAACATGCAGTACCCCAATGTTGGTGGGCGCATGACTCAGC
AGCAGCTTTTGCAGCAACAACATCTTCAAATGCAGATGCAAAATCCTCAGATGCGCCAGCAGTTTACGCCTCAGCAAATGCAACAGTTTACACCTCAGCA
GATGCAGCAATTCCAAGCAGCTCAGCTTCAACGGCGGCAGTTCCAAATGCAGCAAGCGCAACAGCAAGCGCAGATGCAGCGCCAGACTTCTATGCAGCAG
CAGCAACAGCAGCAGCAATTCCAGCAAAACCAGGCAATGCAACGTCAAAATAACATGCGTCAACAGCAACAAATGCAGCAGCCGGGTGCTAACGTGGGTT
ACCCAATGGATGCTGCAAACAAGCAGCAAATGAACCAACGTGGCCAGCAGAATGCCAACTTTTTGCAACAGCAGCAAGCGCAAGCTCAAGCCCAGAATGG
TCAACTCCAGCGCCGCGGATCGATGAATGGAAACAACGCTGGAGGCCGTTTGAGTGCAGATATGAGTTTGGGATCGGGGCTTGGTGCTGAGTCTACAGAT
TTTTTGAATTTGGATTTGCCGCCAGCTCTCTTGGGTGACTCGGATCTTCAAGTCGATGCATCTTCGCTTGGTGGTGGTGTGAACTCAGGCGCAGGGGAAG
CATTGAAAAATCCGGCAGATCCGTCCGTCGCAGGCGTGAAGCGTACGTTGTCTCAATCCCAGCAACAAATGGCAGCGGCAGCAAATNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTCAAGCGAACGAAAGCAGGGGGTCCTGGAGCTAGTGCAGCTGGAAACCGAGGACCGAACTCTCAATCACCACAATCAACACAAAA
CGCCATGCAGAAACCGGTGCAAGGTACAAGTGGTTCATCAAAGACTCCACCAATGAGTACAGTCAATGCAAAATAATGAAAGTAATTCTGATCAAGAGAG
CAAAACCGTTGTGCAAAGCGGACTCATGTACCGCTTCCTTTTGGGAAAGTGTGGAGTTTTGAGAATGATTGGTTCCCCATTGTTTCTCCGAAACAATTGT
CGGTGGGAATGAACCGGTTTGTGCGGGAAAATCGGTTGAAGCTGGTCGCGCCTCGGGTCGAGTCTTGCTGGAAGCTTTTGAAGATGGCATTTTTTTTAAG
TTGGTCGGGCGAACACGAACAAGTTGGCCAGGAGAGAGACAAACGGTAATTGAAAGCGTGTCGATTGTGTTATAGTGCTGATGAAACAAAGTTGATTATT
TTATAGCCTGGAGCAATCATTCGTGTATGTGTTTGGTGCAAGACAATCAAGAGACACTTAAAGCCAGGAGGAAGCACCAAGAGCGGCAAGGAATCTACCC
AGGAAGAGAACAAAACCCAGAAAAAAATAAAGTGTACAAGCGAAAAAGAACTCGAAGCCTCTCTCTTGCTGACTCATTGTGTACGCGGTACCTACTTCAG
GATCCCCTTCCAGCCAAGTGCTGAGTCTCATCCTAAGGTTGGAAGCTGCATTTGTTTATTCTTGTTGTCCTGCTGAAGTTGCCCCTTGACCACGCTTTGC
CTCCTGTTGCCAGACAGGGGCTTGCTAGGTGAAACCGGTGATAAAG