Description :
From Genome Similarity Track
Location :
Scaffold_2990:392- 2112
Transcript NameFunction/comments
Phypl_g15540hypothetical protein PHYSODRAFT_261333

Sequence
1720 bases(100 bases per row)
AACGAGAGAGCTGNTTTCGGCGGCGTCTGAGCGCAGTGTGTGTGAGTTCGGGATCGCTGCTAATTCCAGGGAATCCGCTCCACCACAATGGTGACCGTGT
CCGGATCTCTTGGAGACGCGGGATTTCACCGTGAGTCCCAAGATGATCGCATGTGAGAAATGAATCGGGAGACGAAGCGCCGACGGAATCTAGATCaccg
acggcgtcgctgaaagCGAGATCCACGAATCAACAGAGCCTCGGGAGGGGCCCTGTCGATGGAACGGAGGATATTCTTCTTGAAGAAAACCCTCACATTC
GTCCCCAGGTCCCCTCGGGGACCCCTGTGGATTTTGACTCGAGTCAAGATCCGCAAGGTAAGGCTCCGGTAACGAAAACGATAGGAACCTTACCCACCCC
CAACGCGCCAACCTCAGGTGCTGCAtccaaggacaagaagaagacgagggGCGCACAAAAAAAGCTCAATGCACCGGGATCAGATGGCGAAGACCATGCA
GAGCTAAAGCCTACCTGGTCATGACCCCAGCTAGAGAAGGCATACCGGCGCACGGAGCTACACAGCTTTCTTCACGAAGACCCGGTGATGCAGGTTCTAC
AGCCTGAGCTGCTGGGATCCCTCACCGGACCCGTGTTAGCTcctacgacgacgatggaTAAGCTGGTCGCAGCCATGGACCTGCTGCGGCTACTGGAAGA
GGCAGGCCTCACGGCCGGAGCGTTCGACGCGGAAGCACTCTTCCAGACAGACCGAGACACGATTCGGGTCTCCGCTGCGTCACTCTTCAACCGATTGAAG
ATTCTGGCGGGAGAACGATCGAGACCCAGAAAACTAGAACCCAAGCCTGCACATATGTAGTCCCCTGGGTATCACACTGGATCATCTCTCTATGCGTCCA
CCGAGTCGGAAGCCGGATGCGATAGCCCGTCGGAACCTCGGCGGATGTCGCTGGGCCCAGCTGGCGTCGCGATGCTTAACGTTCGCCTACCAAGCAAAGC
AGGAGATCTAATGGCCGAGCCACGACAAGAGAAGCCGAATGCCGTTCGGACCACGCCGGCGGATCCACCACAAGAGCCGACAGGCCAACTGAAAAGATAC
TTCCAGACAACCATGTCCCGCTTCCTGAAGAAACAACAGACAGCTGCCCCTCCACGACTAAATCCACCTCCACAATCCGGAACGTTGGCTGTCGAAATGG
AGTCGGTAGGATCGCAAGATCACCACCCCGAGCAGTGGGAATACGATCCAGACGACCTCAACAAGACGTCCGCCAGACGCTTGGCGACAACCGCGACCGC
AATAGCTCCGACAGGCTCGTCTTTGGTCCAACGTGTCAAGGTATCAGCAATCTCGGATCCGAAGGAATTCAACGGCAAGGATACGACGAAGAACGCGCGA
GAGCCTGAATCAGCAAGGTTAAGTCCGCATTCACGAGAGACCAAACCCCGGATGAAGAAAAATGCCTCGCGTTCGCGGACTTGCTTACCGGCCCGTGACA
CGTGGCGGCTGGTTCCCAAAAGAACTAGCGCCTTGTCCCAGCATCTTTCGGAGACCTTTGCAGATGGTTGGTCAGGAAatcttgttgttggtggAGAAAG
TTGCCCGTGGCGCCTGAGGAAGACCAAGAGTGATTGTGAAGTTTGAAGTCCGTACGGCATTCTGATTCAGGACAACCTGGTGCGACATACTGAGTTCAAG
TGAAGTGCCGAGGATGACTC