Description :
From Genome Similarity Track
Location :
Scaffold_2509:392- 1966
Sequence
1574 bases(100 bases per row)
GCGCCCTCCAGCGGTCACTTGGGTAGCGAAAAGATATTCCTGTCGGTCTCTCAGGCCTTCTGGTAGACCACAAGTACAAGTGGGTCGCCCGGTACTTGAG
GACATGCGAAACATGTCAGCGGGCTAAGCCCGTAGAGCACGCATCAGCTGCGTTACAGAGCCTGCCCGTTCCGATTGACGGTTGGAAGTCGATGAGTCTT
GACTTCGTCTTTGGGCTCCCCGCCGAAGGACACGGCAACACTGGGATGTTGGTGCTCGTGTGTCGACTGAGCAAGATGGTACATCATGCTCCAGTACCCA
ATACCGCCACAGGCGAACAGACCGCGAGGTTGTTCGTTGATGGCGTGTTCTGCTATCACGGTCTTCCGGAGACGATTAGATCGTTCCGAGACCCGCGGTT
CACGGCCGCGTTTTGGAAAACACTGATTCCTTTTTCTCGGAGTGCATCTGCAGATGTTCACTGCGAATCATCCGGACATAGACGGCCAGACAGGGCGCAT
CAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGAAGACCCACGTACGTGGTCAACGCAGCTTCTAGTTGCTGCGTTTGAGCTCAACAACGCG
GTGCACGCGTCCACGGGGTTTACGCCGTTCTACTTGAATGGCTTCCGCCACTCCAGAGTGCCTCTCACTCTTCAAGGAGACACTGCATCCTCTATTCTAA
GTGGGGGAGAGGCTCGATAAGCTCTTTCCTCCCATGTCACAGACGTGAGACCGGCTTCGCTGGGGAAACAAGTGAGGTCCTTTGTGGATACCAAGCTCCG
CGTGATCAGCAGGGCCCGCTATGCCATGGCAGCGGCCCAGGACAGACAGAAGGAGTACTCTGACAGCCATGGAAGAGGAAACTTAAGTGTGTTTAAGGTA
GATGATTTAGTGTTATTATTCACAAGGAACCTACCGCTAGACATTGTAAGCTCTGTCGGCAGCAACAAACTGAAGAACGGCTTCATTGGACCGTTCGCAG
TCCTGGCCAGGTATGGTGCGTCGTACACCATCGACCTGCCGAAGTCAATGACGATGCACCCGACGTTCTACGTTGGACGTCTTAAGCGGTACCATGATCC
GCAGGGGATTGCTGACTTGCAGACCCACCTTGGAACAACTCCTCGAAGCGAGGGCCGGCCACAGACGTCGACGAGGGTGCCGGAGCAGGCACCCAAGCCT
CAGGATGAAGAGCAAGGCAGCGGTCGAGACCGTACGCCGGACGAACGGACCCCAGGGCCATACGTCGAGTACGTCGAGGAGGTCGGGTACGCACCATACG
CGTACGACTGGGTGAGCGCCGAATGCGGCTCCGGACGTAGCAGCAGAGCCTCGATTTGTCGGATAATGCGGAAGGCCTCGTCAAGATCGGACGAAGAGGC
CCACCTGTCCACCCCCAGATGCAGGCTCGAGACCTCACGCTCCAACAGGTCCAGGCGGCCAGCAGGGCGAGCGAGCACGCCCTGACCCCCGGCCTGGGCG
GCAGAATCTCCGCCAATCCCAAGACCAAGTGCAATCTCAAGCACGAGGACGCGTTGACGGAGGCGGTCAACCTC