Description :
From Genome Similarity Track
Location :
scaffold_15:39198- 42098
Transcript NameFunction/comments
Pl_112301hypothetical protein PHYSODRAFT_300538

Sequence
2900 bases(100 bases per row)
CGAGCAGGTCGCATCGCTCCGACGGCTTCTCCCGTCGTCGTCGCCGCGCCGATAGTGACGACAACACCCACTCAGCATCCCAAGACGCTGGCAATGGCTC
TGACGTCGAAATCATCCACGACTTCCGCTCCAAACGCGAGTTAGAAGCTGAACAAGACGAAGCAAAACTCACACCTGAAGAGCGCGAGCGATTGCGCGAT
CGAGAGGAGCGCGACGCCTTCGCCGAGCGACTGCGTCAACGTGACGAGGACCGCACCAAGCGGAAACGTAAAGCTGAAGAGATTGAGGACCGAGAAGGTC
TAACAAGCGAGGAGATCAAGCAGTTGGCCAAAAGAGGGACAGTTGATGACGGACAGAGCGCGCTGAGTGAGAAACTACGACGTCTCCGAGAACTCAGTAG
ACAGGAGTATCTTAAAAAGAGGGAAGAGAAGGAGCTGGAGCTGCTGGAGTTCCAATTGAAGGACGAGGATGTCCTATTTGAAGAGTCCAAGTGCTCCAAG
AAGGAAAAAGAGCAGCTGGAGCTTAATAAAAGGATCCTGGAGACAGCTAAAGCCAGATCGAAGAAGGAGGAGGTGGACGGGTATCAGATCCCGGACTCTT
ATGAAGAAGTGGATGATGAAGGCAATCGAGTGAGGAAGAAAGAGGATTTATTGACAGATAGATATGAAGAGGAAGAAACTTTTCATACGGAACAGGAAGT
GTGGGAGGAGACGCAAGTGAAAATGGCGACGACCAAGTTTGGAGCGAAGGATAGACACAAGAAGATGGAGGAGGAAGACGAGTTTGTGTTTGATGACCAG
ATTGACTTCATTTCACAACAGATGCTCTCTGGACATCATGTAAGCGATGAAGATGTCAAAGAGGCAAGAAAGAAGATGGAACAAGCCAAACATCTCAGTA
TTCAGGAAGGAAGGAAGCAGTTGCCAGTGTATCCGTATCGAGAATCACTGCTCGAGGCGATCCGGAATTATCCTGTGATTATCATTGAAGGAGAGACCGG
TTCAGGGAAAACGACGCAGATCCCGCAGTATCTACATGAAGTTGGATACTCGGAGTTGGGTACTATTGGTTGTACGCAGCCACGACGTGTTGCTGCCATG
AGTGTGGCAGCTCGTGTCGCGCAGGAAATGGATGTGAAGCTCGGGAATACAGTGGGTTACTCGATTCGTTTTGAGGACTGCACTAGCGACAAGACGGTGA
TCAAGTACATGACGGATGGTATGCTGCTGCGTGAGTTCTTGACCGAACCGGATCTCAAGTCCTACAGTGTCATGATTATTGATGAAGCCCACGAACGCAC
ACTGAGTACAGATATTTTATTCGGTCTTATCAAGGATATTGCGCGCTTCCGTGATGACATCAAGATCATTGTGGCCAGTGCAACGCTTGATGCGACTAAG
TTTAGCGCCTACTTCGATGATGCCCCGATTTTCAAGATTCCTGGACGCATGTTCCCTGTGGATATTTTGTACACAAAGGCTCCTGAGGCTGACTACTTGG
ACGCTGCTATTGTGACAGTGCTGCAGATACACATTACTCAGCCACTGGGTGACATCCTCGTCTTCTTCACCGGTCAGGAGGAAATTGAAGCTGCAGAAGA
GATATTGCTACAACGAACTCGTGGTCTTGGCTCTCGAATTCGCGAGCTACTAATTCGACCAATCTACGCGACACTTCCCTCGGAGCGCCAAGCACAAGTT
TTTGAACCAACACCAGAGGGCGCTCGGAAGGTTGTCCTCAGTACGAATATTGCCGAGACATCGTTGACTATCGCAGGCATTTGCTACGTGATCGACACAG
GCTTTTGCAAACAGACTAACTACAATGCACAGACTGGCATGGAATCATTACTTGTGGCGCCAGTATCACAGGCCATGGCCAATCAACGTGCTGGGCGAGC
TGGCCGTACAGCTCCAGGCAAGTGCTTTCGTTTGTACACTGCGTGGTCATACAAGAACGAGCTAGATGAAAACACTGTGCCAGAGATCCAGCGGACGAAT
CTTGCCAGTGTAGTACTGCTCATGAAATCACTCGGAATCAACGACTTGCTTCACTTTGACTTCATGGATCCTCCACCGGAAAAGGCACTGATTCGCTCAC
TCGAGCAGCTTTATGCTCTTGGCGCTCTGAATGGATTAGGTGAACTCACCAAGTTGGGTCGTCGTATGGCCGAGTTCCCATTGGATCCTATGATGTCCAA
GGCTTTGCTTGCTTCGGAGAAGTTTGGTTGCGTCGAAGAAGTAATGACAGTGTGTGCCATGTTGAGCGTGAATAATTCGATTTTCTACCGACCGAAGGAT
AAAGCAGTTCACGCTGATAATGCGAGACTCAACTTTGCGCGCGGTGGAGGTGGTGATCACATCACATTGATGAACGTTTACAATCAGTGGGTGGAGACGA
ATTACTCAACCCAATGGACATACGAGAACTTCGTGATTATGCGTTCGCTGAAGACTGCGCGCGACGTACGCGAGCAACTTGAGGGTCTGTGTGATCGCGT
GGAGCTTGAGCGCACAAGCAACCGTAGTGATCATGAGCCGATCCGCAAGGCTATCTGCGCAGGTTACTTTTACAACACGGCTAAGCTAGATAACTCAGGC
CACTACAAGACAGTGAAGAAGGCACAGTCTGTACACATTCACCCAAGCTCGTGCCTTATCAAACTTGAAGAAGTCCCGCGTTGGGTCGTATACCACGAAT
TGGCCTTCACGACAAAGGAGTATATGCGCAACGTAATCCCGATCAAGTCCGAGTGGTTGATGGAACTTGCTCCGCATTATTATAAAACCAAAGAAGTTGA
AGATGCTCGCACCAAGAAAATGCCTAAGGCTGTCGGGCGTGCCGGCTAAGCGTTTTGGGTAAATAGATAACGTGCGTTTTCTTGTTATCTATCGTGGAGC